Incidental Mutation 'R5511:Agl'
ID431205
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116788560 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 271 (V271D)
Ref Sequence ENSEMBL: ENSMUSP00000124149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159670] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040603
AA Change: V271D

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: V271D

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159670
SMART Domains Protein: ENSMUSP00000124840
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 7.9e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159742
AA Change: V271D

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: V271D

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162040
Predicted Effect possibly damaging
Transcript: ENSMUST00000162792
AA Change: V271D

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: V271D

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
X0065:Agl UTSW 3 116781330 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTGGGAAAATGTCCTCC -3'
(R):5'- AGAATGGTGATTGTAAAGTGTGACC -3'

Sequencing Primer
(F):5'- CCCAAATTATTTTTCGAATGCACTG -3'
(R):5'- CCCGGAATCTGCATACAA -3'
Posted On2016-10-05