Incidental Mutation 'R5511:Spen'
ID431212
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141475064 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2084 (T2084I)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: T2061I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T2061I

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105786
AA Change: T2084I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T2084I

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTATCTGCCTGGCTAGCTG -3'
(R):5'- TCACCGAGGTCTCAGAAGTC -3'

Sequencing Primer
(F):5'- AGGCAGACGCACTTTCCTC -3'
(R):5'- TCTCAGAAGTCGGCAGCTG -3'
Posted On2016-10-05