Incidental Mutation 'R5511:Raf1'
ID431222
Institutional Source Beutler Lab
Gene Symbol Raf1
Ensembl Gene ENSMUSG00000000441
Gene Namev-raf-leukemia viral oncogene 1
Synonyms6430402F14Rik, Craf1, sarcoma 3611 oncogene, c-Raf, v-Raf, Raf-1
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115618067-115676635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115620256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 28 (S28G)
Ref Sequence ENSEMBL: ENSMUSP00000145520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000449] [ENSMUST00000000451] [ENSMUST00000112949] [ENSMUST00000203759]
Predicted Effect probably benign
Transcript: ENSMUST00000000449
SMART Domains Protein: ENSMUSP00000000449
Gene: ENSMUSG00000000439

DomainStartEndE-ValueType
ZnF_C3H1 2 28 5.02e-6 SMART
ZnF_C3H1 32 57 1.75e-5 SMART
low complexity region 58 85 N/A INTRINSIC
ZnF_C3H1 165 191 2.79e-4 SMART
RING 238 291 5.82e-6 SMART
ZnF_C3H1 322 349 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000451
AA Change: S497G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000000451
Gene: ENSMUSG00000000441
AA Change: S497G

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase 349 606 7.2e-61 PFAM
Pfam:Pkinase_Tyr 349 606 3.5e-65 PFAM
Pfam:Kinase-like 400 596 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112949
AA Change: S497G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108571
Gene: ENSMUSG00000000441
AA Change: S497G

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase_Tyr 349 606 3.4e-64 PFAM
Pfam:Pkinase 349 608 1.1e-61 PFAM
Pfam:Kinase-like 399 596 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect probably benign
Transcript: ENSMUST00000147979
SMART Domains Protein: ENSMUSP00000115424
Gene: ENSMUSG00000000441

DomainStartEndE-ValueType
Blast:RBD 2 28 9e-7 BLAST
PDB:4IHL|P 36 71 1e-9 PDB
low complexity region 110 128 N/A INTRINSIC
PDB:3OMV|B 150 205 6e-33 PDB
SCOP:d1b6cb_ 153 205 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203276
Predicted Effect probably benign
Transcript: ENSMUST00000203759
AA Change: S28G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145520
Gene: ENSMUSG00000000441
AA Change: S28G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 58 1e-6 PFAM
Pfam:Pkinase 1 60 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204512
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are growth retarded, with hypocellular fetal livers, placental anomalies, and defects of skin and lungs, resulting in lethality around mid-gestation. Mice heterozygous for a knock-in allele exhibit hypertrophic cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Raf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Raf1 APN 6 115676569 unclassified probably benign
IGL02379:Raf1 APN 6 115644548 missense probably benign
IGL02427:Raf1 APN 6 115631327 missense probably benign
IGL02586:Raf1 APN 6 115620306 missense probably damaging 0.98
IGL02620:Raf1 APN 6 115632887 splice site probably benign
P0028:Raf1 UTSW 6 115631205 splice site probably benign
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0116:Raf1 UTSW 6 115626383 missense probably damaging 1.00
R0147:Raf1 UTSW 6 115632973 missense probably benign
R0148:Raf1 UTSW 6 115632973 missense probably benign
R0554:Raf1 UTSW 6 115623530 missense probably benign 0.05
R0811:Raf1 UTSW 6 115626710 critical splice donor site probably null
R0812:Raf1 UTSW 6 115626710 critical splice donor site probably null
R1070:Raf1 UTSW 6 115637699 missense probably benign 0.00
R4261:Raf1 UTSW 6 115623054 critical splice acceptor site probably null
R4669:Raf1 UTSW 6 115632919 missense probably damaging 1.00
R4846:Raf1 UTSW 6 115644583 missense possibly damaging 0.91
R5038:Raf1 UTSW 6 115620235 nonsense probably null
R5214:Raf1 UTSW 6 115637622 missense possibly damaging 0.82
R5472:Raf1 UTSW 6 115626706 splice site probably null
R5539:Raf1 UTSW 6 115619356 missense probably damaging 1.00
R5926:Raf1 UTSW 6 115619898 missense probably benign 0.45
R6424:Raf1 UTSW 6 115619581 missense probably benign 0.02
R6649:Raf1 UTSW 6 115631341 missense probably benign 0.03
R7021:Raf1 UTSW 6 115620339 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGTCCTTAGCCCAGGG -3'
(R):5'- CGTTCCCTGTCTCCTGAAAG -3'

Sequencing Primer
(F):5'- GATATGCGGTTTTGCCTTAAGCTAAC -3'
(R):5'- CCCTGTCTCCTGAAAGATTTAGTAG -3'
Posted On2016-10-05