Incidental Mutation 'R5511:Bms1'
ID431223
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118388887 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1113 (F1113L)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032237
AA Change: F1113L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: F1113L

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Meta Mutation Damage Score 0.1880 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R7966:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GACGCTGTCTAGAAACACAGAC -3'
(R):5'- GTCCTGTACTTAGCTGGCTC -3'

Sequencing Primer
(F):5'- TGTCTAGAAACACAGACACTCGTG -3'
(R):5'- GGCTCACACCCAGATCTTTGTG -3'
Posted On2016-10-05