Incidental Mutation 'R5511:Car11'
ID 431228
Institutional Source Beutler Lab
Gene Symbol Car11
Ensembl Gene ENSMUSG00000003273
Gene Name carbonic anhydrase 11
Synonyms CA-RP XI
MMRRC Submission 043072-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5511 (G1)
Quality Score 184
Status Validated
Chromosome 7
Chromosomal Location 45349267-45354106 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45349885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 35 (W35R)
Ref Sequence ENSEMBL: ENSMUSP00000003360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000080885] [ENSMUST00000211513] [ENSMUST00000211357]
AlphaFold O70354
Predicted Effect probably damaging
Transcript: ENSMUST00000003360
AA Change: W35R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273
AA Change: W35R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209796
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211259
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Meta Mutation Damage Score 0.9283 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 T C 3: 59,654,685 (GRCm39) L173P probably damaging Het
Agl A T 3: 116,582,209 (GRCm39) V271D possibly damaging Het
Alox15 G T 11: 70,240,808 (GRCm39) P191T probably benign Het
Apaf1 T C 10: 90,890,254 (GRCm39) Y583C probably damaging Het
Aqp9 T A 9: 71,070,375 (GRCm39) probably benign Het
Bms1 A G 6: 118,365,848 (GRCm39) F1113L possibly damaging Het
Cap1 A C 4: 122,756,583 (GRCm39) probably benign Het
Casc3 T A 11: 98,701,740 (GRCm39) Y91* probably null Het
Ccdc192 G A 18: 57,671,156 (GRCm39) probably null Het
Cd22 A T 7: 30,569,496 (GRCm39) I540N probably damaging Het
Chad A T 11: 94,456,072 (GRCm39) E50V probably damaging Het
Chd3 C G 11: 69,252,301 (GRCm39) G34R probably damaging Het
Col9a1 T C 1: 24,218,619 (GRCm39) V77A unknown Het
Copg1 G A 6: 87,889,276 (GRCm39) V873M probably damaging Het
Dnhd1 T A 7: 105,363,363 (GRCm39) V3975E probably damaging Het
Dock6 A T 9: 21,728,703 (GRCm39) V1290D possibly damaging Het
Elp2 A T 18: 24,745,507 (GRCm39) K150* probably null Het
Eri3 A C 4: 117,472,386 (GRCm39) Y260S possibly damaging Het
Esrrg C T 1: 187,943,304 (GRCm39) L426F probably damaging Het
Farp1 G T 14: 121,474,584 (GRCm39) V266L probably damaging Het
Flnc A G 6: 29,458,897 (GRCm39) E2459G probably damaging Het
Glis1 G A 4: 107,293,074 (GRCm39) D66N probably damaging Het
Gm14129 T A 2: 148,773,446 (GRCm39) noncoding transcript Het
Gm28051 A G 12: 102,686,415 (GRCm39) *82R probably null Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Gne C T 4: 44,041,843 (GRCm39) V485M probably damaging Het
Lcn10 T A 2: 25,572,841 (GRCm39) V15E probably benign Het
Mapk11 T A 15: 89,029,380 (GRCm39) probably null Het
Me3 T G 7: 89,455,876 (GRCm39) Y243D probably damaging Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Myo1h T A 5: 114,483,958 (GRCm39) L519* probably null Het
Myo9a T C 9: 59,687,495 (GRCm39) V200A probably damaging Het
Mzf1 T A 7: 12,785,526 (GRCm39) Q161H possibly damaging Het
Nim1k T G 13: 120,189,130 (GRCm39) H93P probably damaging Het
Nkx6-1 C A 5: 101,811,532 (GRCm39) R190L probably damaging Het
Noc3l A G 19: 38,782,625 (GRCm39) V671A probably benign Het
Nsd1 T C 13: 55,460,543 (GRCm39) S2257P probably benign Het
Nup210 T A 6: 91,003,945 (GRCm39) I648F probably damaging Het
Oplah T C 15: 76,189,944 (GRCm39) E223G possibly damaging Het
Or5b120 T C 19: 13,480,556 (GRCm39) M283T probably benign Het
Plekhs1 A C 19: 56,474,224 (GRCm39) T457P probably damaging Het
Plppr4 G A 3: 117,119,551 (GRCm39) T286I probably benign Het
Prpf4b T C 13: 35,068,037 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,878 (GRCm39) D318E possibly damaging Het
Psap A G 10: 60,134,959 (GRCm39) E289G possibly damaging Het
Rad17 A G 13: 100,764,157 (GRCm39) V438A possibly damaging Het
Raf1 T C 6: 115,597,217 (GRCm39) S28G probably benign Het
Ranbp2 A G 10: 58,329,561 (GRCm39) D2978G probably benign Het
Rnf170 T A 8: 26,631,027 (GRCm39) D213E probably damaging Het
Rsph3a T A 17: 8,164,905 (GRCm39) H88Q possibly damaging Het
Scd1 A G 19: 44,395,198 (GRCm39) I9T probably benign Het
Sgk3 T C 1: 9,968,911 (GRCm39) probably benign Het
Slc14a1 C T 18: 78,145,686 (GRCm39) S416N probably benign Het
Smok4a T C 17: 13,746,474 (GRCm39) noncoding transcript Het
Sostdc1 A T 12: 36,367,165 (GRCm39) I114F probably damaging Het
Spen G A 4: 141,202,375 (GRCm39) T2084I possibly damaging Het
Spen G T 4: 141,244,149 (GRCm39) D295E unknown Het
Sptbn5 T C 2: 119,890,202 (GRCm39) probably benign Het
Srebf1 T C 11: 60,101,184 (GRCm39) probably benign Het
Tcea3 A T 4: 135,998,683 (GRCm39) Y319F probably damaging Het
Timd4 T A 11: 46,710,807 (GRCm39) probably null Het
Tmem88b G A 4: 155,870,002 (GRCm39) P20S probably damaging Het
Tsen2 T A 6: 115,538,365 (GRCm39) C281S probably damaging Het
Vmn2r28 T C 7: 5,487,011 (GRCm39) T551A possibly damaging Het
Vmn2r45 T C 7: 8,474,832 (GRCm39) H732R probably benign Het
Wdr90 A G 17: 26,063,995 (GRCm39) probably benign Het
Zdbf2 T C 1: 63,344,836 (GRCm39) S1072P probably benign Het
Zfp148 A G 16: 33,255,004 (GRCm39) probably benign Het
Zfp2 T A 11: 50,790,851 (GRCm39) E397D probably damaging Het
Zfp729b A G 13: 67,740,499 (GRCm39) F599L probably damaging Het
Other mutations in Car11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Car11 APN 7 45,350,716 (GRCm39) missense probably damaging 0.97
IGL03189:Car11 APN 7 45,351,879 (GRCm39) missense probably damaging 0.98
R1201:Car11 UTSW 7 45,352,904 (GRCm39) missense probably benign
R1625:Car11 UTSW 7 45,350,731 (GRCm39) missense probably benign 0.04
R1670:Car11 UTSW 7 45,352,949 (GRCm39) missense possibly damaging 0.52
R2430:Car11 UTSW 7 45,353,072 (GRCm39) splice site probably null
R2509:Car11 UTSW 7 45,350,783 (GRCm39) missense probably damaging 0.96
R2510:Car11 UTSW 7 45,350,783 (GRCm39) missense probably damaging 0.96
R2680:Car11 UTSW 7 45,351,909 (GRCm39) missense probably benign
R3926:Car11 UTSW 7 45,349,915 (GRCm39) missense probably benign 0.17
R5639:Car11 UTSW 7 45,352,045 (GRCm39) critical splice donor site probably null
R7395:Car11 UTSW 7 45,350,745 (GRCm39) nonsense probably null
R7490:Car11 UTSW 7 45,349,742 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGGCTGGAAGTCCCAAGAG -3'
(R):5'- ATAATGTCCCATGGTGAGCCG -3'

Sequencing Primer
(F):5'- TCCGAGGCCTCTTGGATG -3'
(R):5'- CCCACTCCTGAGGGAAGAAG -3'
Posted On 2016-10-05