Incidental Mutation 'R5511:Ranbp2'
ID431234
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58493739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2978 (D2978G)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310] [ENSMUST00000036576]
Predicted Effect probably benign
Transcript: ENSMUST00000003310
AA Change: D2978G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: D2978G

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036576
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217992
Meta Mutation Damage Score 0.1723 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7958:Ranbp2 UTSW 10 58478455 nonsense probably null
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAATCCCCAGACTTGACCTC -3'
(R):5'- TACTAACAGACCCTTTAGGAGAACC -3'

Sequencing Primer
(F):5'- GGCTGGCTTCAAACTTACAG -3'
(R):5'- GACCCTTTAGGAGAACCAAATGATTC -3'
Posted On2016-10-05