Incidental Mutation 'R5511:Mapk11'
ID431254
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5511 (G1)
Quality Score208
Status Validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 89145177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823] [ENSMUST00000088827]
Predicted Effect probably null
Transcript: ENSMUST00000088823
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zdbf2 T C 1: 63,305,677 S1072P probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTCCTCATGCGATGCC -3'
(R):5'- CCCTCTTTCCTGGAAACGAC -3'

Sequencing Primer
(F):5'- CATGCGATGCCATTTCTGC -3'
(R):5'- AACGACTGTATCCTTGGGGAGC -3'
Posted On2016-10-05