Incidental Mutation 'R0469:Lmtk3'
ID43126
Institutional Source Beutler Lab
Gene Symbol Lmtk3
Ensembl Gene ENSMUSG00000062044
Gene Namelemur tyrosine kinase 3
SynonymsAATYK3, Aatyk3
MMRRC Submission 038669-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R0469 (G1)
Quality Score143
Status Not validated
Chromosome7
Chromosomal Location45783738-45804144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45794112 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 740 (L740M)
Ref Sequence ENSEMBL: ENSMUSP00000148041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072580
AA Change: L714M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: L714M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118564
AA Change: L740M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113323
Gene: ENSMUSG00000062044
AA Change: L740M

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Pkinase_Tyr 159 434 4.2e-64 PFAM
Pfam:Pkinase 159 436 1.3e-33 PFAM
low complexity region 441 470 N/A INTRINSIC
low complexity region 510 532 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 665 695 N/A INTRINSIC
low complexity region 761 817 N/A INTRINSIC
low complexity region 823 869 N/A INTRINSIC
low complexity region 1107 1131 N/A INTRINSIC
low complexity region 1142 1158 N/A INTRINSIC
low complexity region 1222 1249 N/A INTRINSIC
low complexity region 1251 1289 N/A INTRINSIC
low complexity region 1371 1388 N/A INTRINSIC
low complexity region 1410 1419 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120005
AA Change: L714M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: L714M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209351
Predicted Effect possibly damaging
Transcript: ENSMUST00000209617
AA Change: L740M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000209701
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
B3gntl1 A T 11: 121,673,025 V3D probably benign Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Golgb1 A G 16: 36,931,635 I3144V probably benign Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr338 A T 2: 36,377,462 I229F probably benign Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rbmx C T X: 57,391,566 probably null Het
Rbp3 A G 14: 33,962,419 K1135R possibly damaging Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tm9sf1 A T 14: 55,641,429 F169I possibly damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,423,667 probably null Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Upb1 T C 10: 75,415,083 probably null Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Lmtk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lmtk3 APN 7 45790907 missense probably damaging 1.00
IGL01996:Lmtk3 APN 7 45793447 splice site probably null
IGL02146:Lmtk3 APN 7 45794947 unclassified probably benign
IGL02192:Lmtk3 APN 7 45794509 unclassified probably benign
IGL02598:Lmtk3 APN 7 45793140 missense probably damaging 1.00
BB006:Lmtk3 UTSW 7 45795148 missense unknown
BB016:Lmtk3 UTSW 7 45795148 missense unknown
R0510:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0603:Lmtk3 UTSW 7 45795556 unclassified probably benign
R0781:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1110:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1270:Lmtk3 UTSW 7 45793828 missense probably damaging 0.96
R1535:Lmtk3 UTSW 7 45794570 unclassified probably benign
R1666:Lmtk3 UTSW 7 45794164 missense probably benign 0.03
R1807:Lmtk3 UTSW 7 45793278 missense probably benign 0.02
R1883:Lmtk3 UTSW 7 45786849 missense probably damaging 1.00
R2060:Lmtk3 UTSW 7 45800911 critical splice acceptor site probably null
R2107:Lmtk3 UTSW 7 45793969 missense possibly damaging 0.56
R2214:Lmtk3 UTSW 7 45794853 unclassified probably benign
R2369:Lmtk3 UTSW 7 45795088 unclassified probably benign
R4084:Lmtk3 UTSW 7 45793292 missense probably damaging 0.97
R4246:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4247:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4249:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4250:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4587:Lmtk3 UTSW 7 45794080 missense possibly damaging 0.92
R5026:Lmtk3 UTSW 7 45794412 unclassified probably benign
R5275:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5295:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5624:Lmtk3 UTSW 7 45786862 missense probably damaging 0.96
R5688:Lmtk3 UTSW 7 45791410 missense probably damaging 1.00
R6478:Lmtk3 UTSW 7 45798589 missense unknown
R6737:Lmtk3 UTSW 7 45793627 missense probably damaging 0.99
R6800:Lmtk3 UTSW 7 45793809 missense possibly damaging 0.91
R6856:Lmtk3 UTSW 7 45794297 unclassified probably benign
R7319:Lmtk3 UTSW 7 45794316 missense unknown
R7335:Lmtk3 UTSW 7 45795157 missense unknown
R7353:Lmtk3 UTSW 7 45788000 missense possibly damaging 0.46
R7621:Lmtk3 UTSW 7 45793417 missense probably damaging 1.00
R7699:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7700:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7836:Lmtk3 UTSW 7 45786903 missense possibly damaging 0.89
R7929:Lmtk3 UTSW 7 45795148 missense unknown
R7951:Lmtk3 UTSW 7 45785606 missense probably benign 0.01
R7976:Lmtk3 UTSW 7 45795466 missense unknown
R8128:Lmtk3 UTSW 7 45794174 missense
X0052:Lmtk3 UTSW 7 45793498 missense probably benign 0.03
X0067:Lmtk3 UTSW 7 45794680 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGACAGCAGCAGCCTTGGA -3'
(R):5'- GCTCGGTGCTCACCTGAACTACAAA -3'

Sequencing Primer
(F):5'- CAGCCTTGGAGGGGGAC -3'
(R):5'- TCACCTGAACTACAAAGGTTGG -3'
Posted On2013-05-23