Incidental Mutation 'R5516:Trmt10a'
ID431270
Institutional Source Beutler Lab
Gene Symbol Trmt10a
Ensembl Gene ENSMUSG00000004127
Gene NametRNA methyltransferase 10A
Synonyms3110023L08Rik, Rg9mtd2
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5516 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138143448-138159821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138152196 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 168 (I168T)
Ref Sequence ENSEMBL: ENSMUSP00000125749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040321] [ENSMUST00000159481] [ENSMUST00000159622] [ENSMUST00000161141] [ENSMUST00000162864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040321
AA Change: I168T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042082
Gene: ENSMUSG00000004127
AA Change: I168T

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 3.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159481
SMART Domains Protein: ENSMUSP00000124465
Gene: ENSMUSG00000004127

DomainStartEndE-ValueType
coiled coil region 44 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159622
SMART Domains Protein: ENSMUSP00000130478
Gene: ENSMUSG00000004127

DomainStartEndE-ValueType
low complexity region 44 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161141
SMART Domains Protein: ENSMUSP00000125681
Gene: ENSMUSG00000004127

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 165 2.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161791
Predicted Effect possibly damaging
Transcript: ENSMUST00000162864
AA Change: I168T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125749
Gene: ENSMUSG00000004127
AA Change: I168T

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 2.7e-33 PFAM
Meta Mutation Damage Score 0.2825 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the tRNA (Guanine-1)-methyltransferase family. A similar gene in yeast modifies several different tRNA species. Mutations in this gene are associated with microcephaly, short stature, and impaired glucose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating magnesium level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Trmt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00563:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00771:Trmt10a APN 3 138150455 missense probably benign 0.08
IGL01140:Trmt10a APN 3 138156698 splice site probably benign
IGL02869:Trmt10a APN 3 138152184 splice site probably null
R0898:Trmt10a UTSW 3 138149518 missense probably damaging 1.00
R0975:Trmt10a UTSW 3 138156809 missense probably benign 0.41
R1511:Trmt10a UTSW 3 138152184 splice site probably null
R1872:Trmt10a UTSW 3 138156720 missense probably damaging 1.00
R4856:Trmt10a UTSW 3 138148385 nonsense probably null
R4880:Trmt10a UTSW 3 138152211 missense possibly damaging 0.64
R4886:Trmt10a UTSW 3 138148385 nonsense probably null
R5399:Trmt10a UTSW 3 138147504 missense probably damaging 0.97
R5994:Trmt10a UTSW 3 138156714 missense probably damaging 1.00
R7272:Trmt10a UTSW 3 138154766 missense probably damaging 1.00
X0028:Trmt10a UTSW 3 138154795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGATTAGGAACTGGGCCCC -3'
(R):5'- CGTTCACTCTTAGGATTTTGTCAGG -3'

Sequencing Primer
(F):5'- CAGCCGAGGGAGTGAGGTTG -3'
(R):5'- TCAGGTTCTAGGGAGGAGC -3'
Posted On2016-10-05