Incidental Mutation 'R5516:Bmp2k'
ID431275
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene NameBMP2 inducible kinase
Synonyms4933417M22Rik, BIKE
MMRRC Submission 043075-MU
Accession Numbers

Genbank: NM_080708; MGI: 2155456

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R5516 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96997689-97091867 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 97087453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000069453] [ENSMUST00000112969]
Predicted Effect unknown
Transcript: ENSMUST00000035635
AA Change: F912I
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: F912I

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069453
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97063548 splice site probably null
IGL01408:Bmp2k APN 5 97086964 nonsense probably null
IGL02146:Bmp2k APN 5 97064830 missense unknown
IGL02232:Bmp2k APN 5 97031250 splice site probably benign
3-1:Bmp2k UTSW 5 97053120 missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0284:Bmp2k UTSW 5 97068455 missense unknown
R0323:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97031125 splice site probably benign
R0726:Bmp2k UTSW 5 97087494 utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97053200 missense probably benign 0.16
R1686:Bmp2k UTSW 5 97063533 missense unknown
R1826:Bmp2k UTSW 5 97061402 splice site probably benign
R3842:Bmp2k UTSW 5 97087151 utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97074740 missense unknown
R4649:Bmp2k UTSW 5 97053111 missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97086764 unclassified probably benign
R4975:Bmp2k UTSW 5 97087085 utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97053142 missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97087015 utr 3 prime probably benign
R5260:Bmp2k UTSW 5 97087351 utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97087191 frame shift probably null
R5807:Bmp2k UTSW 5 97063494 missense unknown
R5835:Bmp2k UTSW 5 97056982 missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97087736 utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97063608 intron probably null
R6546:Bmp2k UTSW 5 97088078 missense probably benign 0.32
R6664:Bmp2k UTSW 5 97088130 missense probably benign 0.03
R6962:Bmp2k UTSW 5 97031238 nonsense probably null
R7081:Bmp2k UTSW 5 97064961 missense unknown
R7267:Bmp2k UTSW 5 97068434 missense unknown
R7473:Bmp2k UTSW 5 97057012 missense probably benign 0.40
R7498:Bmp2k UTSW 5 97088119 missense probably benign 0.03
R7659:Bmp2k UTSW 5 97074719 missense unknown
X0026:Bmp2k UTSW 5 97038533 missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97053156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGTCAGGAGTTCGATGTG -3'
(R):5'- GACACATCCTGCTTTGTGCG -3'

Sequencing Primer
(F):5'- ATGTGTTTGGCGCTGTTCCC -3'
(R):5'- TGCGTCTCTGGCGAGAG -3'
Posted On2016-10-05