Incidental Mutation 'R5516:Vmn2r11'
ID431276
Institutional Source Beutler Lab
Gene Symbol Vmn2r11
Ensembl Gene ENSMUSG00000091450
Gene Namevomeronasal 2, receptor 11
SynonymsEG384219
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5516 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109046873-109059452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109047166 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 765 (S765P)
Ref Sequence ENSEMBL: ENSMUSP00000133218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164875]
Predicted Effect probably damaging
Transcript: ENSMUST00000164875
AA Change: S765P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: S765P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 167 475 1.6e-29 PFAM
Pfam:NCD3G 520 574 9.1e-19 PFAM
Pfam:7tm_3 607 842 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Vmn2r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn2r11 APN 5 109047019 missense probably benign 0.00
IGL01677:Vmn2r11 APN 5 109053957 missense possibly damaging 0.50
IGL02048:Vmn2r11 APN 5 109054792 missense probably benign 0.00
IGL02559:Vmn2r11 APN 5 109052180 missense probably damaging 0.98
IGL02879:Vmn2r11 APN 5 109053838 missense possibly damaging 0.95
IGL03084:Vmn2r11 APN 5 109059343 missense probably benign 0.00
IGL03163:Vmn2r11 APN 5 109053826 missense probably benign 0.41
IGL03289:Vmn2r11 APN 5 109048922 splice site probably benign
IGL03294:Vmn2r11 APN 5 109054069 missense probably benign 0.22
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0421:Vmn2r11 UTSW 5 109059428 missense probably benign 0.00
R0549:Vmn2r11 UTSW 5 109052097 missense possibly damaging 0.80
R0628:Vmn2r11 UTSW 5 109047731 missense possibly damaging 0.88
R1523:Vmn2r11 UTSW 5 109053841 missense probably benign 0.25
R1660:Vmn2r11 UTSW 5 109053858 missense possibly damaging 0.79
R1827:Vmn2r11 UTSW 5 109052072 missense probably benign 0.01
R1913:Vmn2r11 UTSW 5 109054788 missense probably benign
R2260:Vmn2r11 UTSW 5 109053791 nonsense probably null
R2400:Vmn2r11 UTSW 5 109052062 missense probably benign 0.03
R3933:Vmn2r11 UTSW 5 109053394 missense probably damaging 0.97
R4091:Vmn2r11 UTSW 5 109054750 critical splice donor site probably null
R4624:Vmn2r11 UTSW 5 109052235 missense probably damaging 0.99
R4762:Vmn2r11 UTSW 5 109047570 missense probably damaging 1.00
R5256:Vmn2r11 UTSW 5 109054792 missense probably benign 0.26
R5370:Vmn2r11 UTSW 5 109047555 missense probably damaging 1.00
R5419:Vmn2r11 UTSW 5 109059358 missense possibly damaging 0.55
R5643:Vmn2r11 UTSW 5 109047003 missense probably damaging 1.00
R5671:Vmn2r11 UTSW 5 109054906 missense probably benign 0.03
R5679:Vmn2r11 UTSW 5 109054842 missense probably benign 0.00
R5739:Vmn2r11 UTSW 5 109059248 critical splice donor site probably null
R5746:Vmn2r11 UTSW 5 109053694 missense probably benign 0.41
R5995:Vmn2r11 UTSW 5 109047055 missense probably damaging 1.00
R6147:Vmn2r11 UTSW 5 109054834 missense probably benign 0.04
R6220:Vmn2r11 UTSW 5 109053568 missense probably benign 0.09
R6374:Vmn2r11 UTSW 5 109053813 missense possibly damaging 0.65
R6491:Vmn2r11 UTSW 5 109048934 missense possibly damaging 0.95
R6804:Vmn2r11 UTSW 5 109053484 missense probably damaging 1.00
R6814:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R6872:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R7014:Vmn2r11 UTSW 5 109053423 missense probably damaging 1.00
R7041:Vmn2r11 UTSW 5 109054950 missense probably damaging 1.00
R7043:Vmn2r11 UTSW 5 109052232 missense probably benign 0.00
R7050:Vmn2r11 UTSW 5 109054791 missense probably benign 0.05
R7184:Vmn2r11 UTSW 5 109053415 missense probably damaging 1.00
R7388:Vmn2r11 UTSW 5 109054876 missense probably benign 0.05
R7477:Vmn2r11 UTSW 5 109059348 missense possibly damaging 0.67
R7524:Vmn2r11 UTSW 5 109053982 missense probably benign 0.01
R7682:Vmn2r11 UTSW 5 109047615 missense probably benign 0.02
R7715:Vmn2r11 UTSW 5 109047441 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTTGGGAGAAAGATGCACCC -3'
(R):5'- GGCACCTAACTTGGTCATTCCC -3'

Sequencing Primer
(F):5'- CCTGCACTAGAAGCCAAGATGG -3'
(R):5'- AACTTGGTCATTCCCATTTGTAC -3'
Posted On2016-10-05