Incidental Mutation 'R5516:Fam222a'
ID431277
Institutional Source Beutler Lab
Gene Symbol Fam222a
Ensembl Gene ENSMUSG00000041930
Gene Namefamily with sequence similarity 222, member A
Synonyms
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5516 (G1)
Quality Score147
Status Validated
Chromosome5
Chromosomal Location114568016-114613220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114611828 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 362 (Y362H)
Ref Sequence ENSEMBL: ENSMUSP00000045724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043650]
Predicted Effect probably damaging
Transcript: ENSMUST00000043650
AA Change: Y362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045724
Gene: ENSMUSG00000041930
AA Change: Y362H

DomainStartEndE-ValueType
Pfam:FAM222A 30 157 8e-42 PFAM
low complexity region 181 202 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.2436 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Fam222a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Fam222a APN 5 114594453 missense possibly damaging 0.77
PIT4585001:Fam222a UTSW 5 114611040 missense probably damaging 1.00
R2296:Fam222a UTSW 5 114610966 missense possibly damaging 0.89
R3087:Fam222a UTSW 5 114611954 missense probably damaging 1.00
R4837:Fam222a UTSW 5 114594397 nonsense probably null
R5201:Fam222a UTSW 5 114611066 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAGAAGGTGGCCTGGATTAC -3'
(R):5'- CGGATGTCGTTGATGAGATACTC -3'

Sequencing Primer
(F):5'- TGGATTACCTGCTGTGGCCAC -3'
(R):5'- TCGTTGATGAGATACTCCAGCGAC -3'
Posted On2016-10-05