Incidental Mutation 'R5516:Aldh1l1'
ID 431279
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Name aldehyde dehydrogenase 1 family, member L1
Synonyms Fthfd, 1810048F20Rik
MMRRC Submission 043075-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5516 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 90527751-90576153 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90573927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 809 (I809F)
Ref Sequence ENSEMBL: ENSMUSP00000114304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000204796]
AlphaFold Q8R0Y6
Predicted Effect possibly damaging
Transcript: ENSMUST00000032175
AA Change: I809F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: I809F

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130418
AA Change: I809F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: I809F

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161447
Predicted Effect probably benign
Transcript: ENSMUST00000204796
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,306,901 (GRCm39) K334R probably damaging Het
Bmp2k T A 5: 97,235,312 (GRCm39) probably benign Het
C1qtnf9 T A 14: 61,017,198 (GRCm39) C243S probably damaging Het
Cacna1c G A 6: 119,034,179 (GRCm39) A146V probably damaging Het
Ccdc85c A G 12: 108,174,109 (GRCm39) V353A probably damaging Het
Cd300ld2 G T 11: 114,903,270 (GRCm39) probably benign Het
Cd320 A G 17: 34,067,021 (GRCm39) Q170R possibly damaging Het
Cfap43 C T 19: 47,726,648 (GRCm39) probably null Het
Chid1 A G 7: 141,076,059 (GRCm39) S365P probably damaging Het
Chrna7 T G 7: 62,749,046 (GRCm39) T479P probably damaging Het
Clasp1 G T 1: 118,425,451 (GRCm39) R35L probably damaging Het
Cluh G A 11: 74,551,270 (GRCm39) R373H probably damaging Het
Cyp2b23 G A 7: 26,372,482 (GRCm39) R378* probably null Het
Cyp2d9 T G 15: 82,338,528 (GRCm39) N136K probably null Het
Efcab5 A T 11: 77,079,615 (GRCm39) S44T possibly damaging Het
Esrrg A T 1: 187,930,927 (GRCm39) L316F possibly damaging Het
Fam222a T C 5: 114,749,889 (GRCm39) Y362H probably damaging Het
Fat3 A G 9: 15,910,005 (GRCm39) V1999A probably damaging Het
Fes A T 7: 80,036,931 (GRCm39) M51K probably damaging Het
Fmo3 T A 1: 162,781,995 (GRCm39) K453* probably null Het
Galnt1 A G 18: 24,413,074 (GRCm39) N458S probably benign Het
Gm8888 T A 15: 96,664,855 (GRCm39) noncoding transcript Het
Gpn2 G A 4: 133,312,190 (GRCm39) probably null Het
Grm4 G A 17: 27,657,385 (GRCm39) T464I probably benign Het
Insr T A 8: 3,205,764 (GRCm39) K1342* probably null Het
Krt87 T A 15: 101,385,002 (GRCm39) K365* probably null Het
Lfng T C 5: 140,599,018 (GRCm39) L309P probably damaging Het
Lnpk T C 2: 74,378,132 (GRCm39) probably benign Het
Lrrc8e A C 8: 4,285,818 (GRCm39) D681A probably damaging Het
Lyst G A 13: 13,818,707 (GRCm39) D1326N probably benign Het
Mmp27 A G 9: 7,579,063 (GRCm39) R413G probably null Het
Nags C T 11: 102,036,773 (GRCm39) Q121* probably null Het
Nectin1 A G 9: 43,715,090 (GRCm39) E442G probably benign Het
Nek1 G C 8: 61,542,523 (GRCm39) A729P probably benign Het
Or51a24 A G 7: 103,733,444 (GRCm39) I281T possibly damaging Het
Pnp2 C T 14: 51,201,195 (GRCm39) A189V probably benign Het
Ppm1m T A 9: 106,075,138 (GRCm39) I136F probably damaging Het
Pramel21 A G 4: 143,342,253 (GRCm39) Q120R possibly damaging Het
Psg17 G T 7: 18,548,458 (GRCm39) Q438K probably benign Het
Ptprk C T 10: 28,372,926 (GRCm39) R726* probably null Het
Rab3gap2 A T 1: 184,967,684 (GRCm39) Y163F probably benign Het
Scrib A T 15: 75,934,712 (GRCm39) L627Q possibly damaging Het
Tcp1 A G 17: 13,143,221 (GRCm39) K510R probably damaging Het
Tle4 A T 19: 14,432,253 (GRCm39) I481N probably damaging Het
Tmem43 G T 6: 91,455,192 (GRCm39) R56L possibly damaging Het
Trmt10a T C 3: 137,857,957 (GRCm39) I168T possibly damaging Het
Trpv1 A T 11: 73,136,809 (GRCm39) Y96F probably benign Het
Tshz3 C T 7: 36,469,775 (GRCm39) T588I probably benign Het
Ugt2b38 A G 5: 87,559,702 (GRCm39) F397L probably damaging Het
Vmn2r11 A G 5: 109,195,032 (GRCm39) S765P probably damaging Het
Zfp668 A G 7: 127,466,318 (GRCm39) F289L probably damaging Het
Zfp735 A G 11: 73,601,640 (GRCm39) T195A probably benign Het
Zscan10 A G 17: 23,828,333 (GRCm39) T182A possibly damaging Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90,575,362 (GRCm39) missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90,536,338 (GRCm39) missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90,568,823 (GRCm39) missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90,536,215 (GRCm39) splice site probably benign
IGL01868:Aldh1l1 APN 6 90,560,212 (GRCm39) nonsense probably null
IGL01941:Aldh1l1 APN 6 90,539,677 (GRCm39) missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90,536,845 (GRCm39) missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90,557,572 (GRCm39) splice site probably benign
IGL02159:Aldh1l1 APN 6 90,571,638 (GRCm39) splice site probably benign
IGL02450:Aldh1l1 APN 6 90,546,855 (GRCm39) missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90,567,776 (GRCm39) missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90,546,857 (GRCm39) missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90,566,396 (GRCm39) missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90,546,848 (GRCm39) missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90,546,848 (GRCm39) missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90,546,875 (GRCm39) missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90,566,366 (GRCm39) missense probably benign
R1467:Aldh1l1 UTSW 6 90,548,910 (GRCm39) missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90,548,910 (GRCm39) missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90,541,371 (GRCm39) missense probably benign
R1793:Aldh1l1 UTSW 6 90,554,813 (GRCm39) missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90,534,314 (GRCm39) missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90,539,647 (GRCm39) missense probably benign 0.00
R2229:Aldh1l1 UTSW 6 90,560,168 (GRCm39) missense probably damaging 1.00
R2426:Aldh1l1 UTSW 6 90,575,266 (GRCm39) missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90,539,626 (GRCm39) missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90,573,897 (GRCm39) missense probably benign
R5214:Aldh1l1 UTSW 6 90,540,399 (GRCm39) missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90,553,752 (GRCm39) nonsense probably null
R5426:Aldh1l1 UTSW 6 90,536,281 (GRCm39) missense probably benign
R5970:Aldh1l1 UTSW 6 90,574,028 (GRCm39) intron probably benign
R6235:Aldh1l1 UTSW 6 90,541,439 (GRCm39) missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90,539,680 (GRCm39) missense probably benign 0.03
R7053:Aldh1l1 UTSW 6 90,540,420 (GRCm39) missense possibly damaging 0.50
R7125:Aldh1l1 UTSW 6 90,553,761 (GRCm39) critical splice donor site probably null
R7128:Aldh1l1 UTSW 6 90,540,361 (GRCm39) missense probably benign 0.23
R7142:Aldh1l1 UTSW 6 90,540,398 (GRCm39) missense probably damaging 1.00
R7203:Aldh1l1 UTSW 6 90,547,782 (GRCm39) missense probably benign 0.01
R7205:Aldh1l1 UTSW 6 90,575,257 (GRCm39) missense probably damaging 0.97
R7477:Aldh1l1 UTSW 6 90,575,369 (GRCm39) critical splice donor site probably null
R7669:Aldh1l1 UTSW 6 90,547,844 (GRCm39) missense probably benign
R7718:Aldh1l1 UTSW 6 90,575,305 (GRCm39) missense probably damaging 1.00
R7788:Aldh1l1 UTSW 6 90,546,894 (GRCm39) missense probably benign 0.20
R8438:Aldh1l1 UTSW 6 90,536,428 (GRCm39) missense probably damaging 1.00
R8922:Aldh1l1 UTSW 6 90,536,256 (GRCm39) missense probably damaging 1.00
R8969:Aldh1l1 UTSW 6 90,547,790 (GRCm39) missense probably benign
R9292:Aldh1l1 UTSW 6 90,568,867 (GRCm39) missense probably damaging 0.98
R9427:Aldh1l1 UTSW 6 90,536,903 (GRCm39) missense probably benign 0.06
R9560:Aldh1l1 UTSW 6 90,536,825 (GRCm39) missense probably damaging 1.00
R9771:Aldh1l1 UTSW 6 90,575,310 (GRCm39) missense probably benign 0.25
R9784:Aldh1l1 UTSW 6 90,541,424 (GRCm39) missense probably benign 0.07
RF007:Aldh1l1 UTSW 6 90,575,241 (GRCm39) missense probably damaging 0.99
Z1176:Aldh1l1 UTSW 6 90,560,155 (GRCm39) missense probably benign 0.11
Z1176:Aldh1l1 UTSW 6 90,534,266 (GRCm39) frame shift probably null
Z1177:Aldh1l1 UTSW 6 90,541,431 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACAGAGTGCCGTGTGAG -3'
(R):5'- ACATGAGAGGATATTGGCTTTTGC -3'

Sequencing Primer
(F):5'- AGTGCCGTGTGAGCCAGG -3'
(R):5'- GGGAAGCCAGAACCTCTTTTG -3'
Posted On 2016-10-05