Incidental Mutation 'R5516:Tmem43'
ID431280
Institutional Source Beutler Lab
Gene Symbol Tmem43
Ensembl Gene ENSMUSG00000030095
Gene Nametransmembrane protein 43
Synonyms1200015A22Rik, LUMA
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5516 (G1)
Quality Score97
Status Validated
Chromosome6
Chromosomal Location91473703-91488463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91478210 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 56 (R56L)
Ref Sequence ENSEMBL: ENSMUSP00000032183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032183] [ENSMUST00000040835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032183
AA Change: R56L

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095
AA Change: R56L

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040835
SMART Domains Protein: ENSMUSP00000041380
Gene: ENSMUSG00000034203

DomainStartEndE-ValueType
Pfam:CHCH 64 100 8.4e-12 PFAM
low complexity region 109 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205954
Meta Mutation Damage Score 0.8516 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
PHENOTYPE: In a gihg-throughput screen, female homozygous mutant mice exhibited an increased anxiety-like response during open field activity testing when compared with their gender-matched wild-type littermates and the historical mean. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Tmem43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem43 APN 6 91477374 missense possibly damaging 0.73
IGL03105:Tmem43 APN 6 91480700 missense probably damaging 1.00
R0415:Tmem43 UTSW 6 91482318 missense probably benign 0.13
R1388:Tmem43 UTSW 6 91478803 splice site probably null
R1581:Tmem43 UTSW 6 91478735 missense probably benign 0.01
R1777:Tmem43 UTSW 6 91477330 nonsense probably null
R1895:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R1946:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R2697:Tmem43 UTSW 6 91479929 missense possibly damaging 0.85
R4778:Tmem43 UTSW 6 91482255 missense probably damaging 1.00
R5205:Tmem43 UTSW 6 91486781 missense possibly damaging 0.89
R5366:Tmem43 UTSW 6 91478258 missense probably benign 0.43
R5383:Tmem43 UTSW 6 91473890 missense probably benign 0.00
R5569:Tmem43 UTSW 6 91477354 missense probably benign 0.01
R5656:Tmem43 UTSW 6 91480708 missense probably benign 0.01
R6490:Tmem43 UTSW 6 91478777 missense probably damaging 0.97
R6490:Tmem43 UTSW 6 91486880 missense possibly damaging 0.91
R7853:Tmem43 UTSW 6 91481986 missense probably benign 0.06
R7936:Tmem43 UTSW 6 91481986 missense probably benign 0.06
S24628:Tmem43 UTSW 6 91482318 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGATTAGCGGGGTCTTCCTG -3'
(R):5'- GACTGAGAAGTGACCTGTCC -3'

Sequencing Primer
(F):5'- TCTTCCTGGGAAAGCAGGGATC -3'
(R):5'- ACACAGCCATGGAGGTTCTG -3'
Posted On2016-10-05