Incidental Mutation 'R0469:Wdr73'
ID 43129
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 038669-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R0469 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 80897950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 107 (Q107*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
AlphaFold Q9CWR1
Predicted Effect probably null
Transcript: ENSMUST00000026816
AA Change: Q109*
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: Q109*

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145923
Predicted Effect probably null
Transcript: ENSMUST00000146402
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: Q107*

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
B3gntl1 A T 11: 121,673,025 V3D probably benign Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Golgb1 A G 16: 36,931,635 I3144V probably benign Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr338 A T 2: 36,377,462 I229F probably benign Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rbmx C T X: 57,391,566 probably null Het
Rbp3 A G 14: 33,962,419 K1135R possibly damaging Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tm9sf1 A T 14: 55,641,429 F169I possibly damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,423,667 probably null Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Upb1 T C 10: 75,415,083 probably null Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTAGACAGAAACTGTGCTGTCCCC -3'
(R):5'- TGTCTGAAAGCTGACAGACGCC -3'

Sequencing Primer
(F):5'- CACCCCGTGAACTTTACTCA -3'
(R):5'- CGCCACAGAAGTTCAGGTTTTAG -3'
Posted On 2013-05-23