Incidental Mutation 'R5516:Ppm1m'
ID 431296
Institutional Source Beutler Lab
Gene Symbol Ppm1m
Ensembl Gene ENSMUSG00000020253
Gene Name protein phosphatase 1M
Synonyms 2810423O19Rik, PP2C eta
MMRRC Submission 043075-MU
Accession Numbers

Ncbi RefSeq: NM_026447.4, NM_198931.3; MGI:1915155

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5516 (G1)
Quality Score 219
Status Validated
Chromosome 9
Chromosomal Location 106194947-106199746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106197939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 136 (I136F)
Ref Sequence ENSEMBL: ENSMUSP00000117908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076258] [ENSMUST00000140761]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000076258
AA Change: I80F

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075607
Gene: ENSMUSG00000020253
AA Change: I80F

DomainStartEndE-ValueType
PP2Cc 14 394 7.38e-44 SMART
PP2C_SIG 50 396 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136431
SMART Domains Protein: ENSMUSP00000118165
Gene: ENSMUSG00000020253

DomainStartEndE-ValueType
PP2Cc 2 200 1.93e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140761
AA Change: I136F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117908
Gene: ENSMUSG00000020253
AA Change: I136F

DomainStartEndE-ValueType
PP2Cc 60 450 8.04e-45 SMART
PP2C_SIG 106 452 1.51e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152359
Predicted Effect probably benign
Transcript: ENSMUST00000213197
Predicted Effect probably benign
Transcript: ENSMUST00000215742
Meta Mutation Damage Score 0.1445 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(8) : Targeted(2) Gene trapped(6)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Ppm1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Ppm1m APN 9 106199157 missense probably damaging 0.96
IGL02090:Ppm1m APN 9 106196802 critical splice donor site probably null
IGL02644:Ppm1m APN 9 106196883 missense probably damaging 1.00
IGL02691:Ppm1m APN 9 106195369 missense probably damaging 1.00
IGL03094:Ppm1m APN 9 106196411 missense probably damaging 1.00
R0047:Ppm1m UTSW 9 106196696 nonsense probably null
R0047:Ppm1m UTSW 9 106196696 nonsense probably null
R0361:Ppm1m UTSW 9 106198126 missense probably damaging 1.00
R0452:Ppm1m UTSW 9 106197302 missense probably damaging 1.00
R3053:Ppm1m UTSW 9 106198675 missense probably benign
R4654:Ppm1m UTSW 9 106196402 missense probably damaging 1.00
R5121:Ppm1m UTSW 9 106195805 missense probably benign 0.03
R5450:Ppm1m UTSW 9 106196842 missense probably benign 0.02
R6278:Ppm1m UTSW 9 106197228 missense probably damaging 1.00
R6533:Ppm1m UTSW 9 106196870 unclassified probably benign
R6746:Ppm1m UTSW 9 106198152 nonsense probably null
R7466:Ppm1m UTSW 9 106196157 missense probably damaging 0.99
R7486:Ppm1m UTSW 9 106196611 missense probably damaging 1.00
R7892:Ppm1m UTSW 9 106198696 missense probably benign
R7936:Ppm1m UTSW 9 106197945 missense probably damaging 1.00
R8815:Ppm1m UTSW 9 106199038 unclassified probably benign
R9643:Ppm1m UTSW 9 106197905 missense probably damaging 1.00
X0022:Ppm1m UTSW 9 106198122 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCACACATTCCTGGAAGG -3'
(R):5'- ACATCAAGAGTGGCTGACG -3'

Sequencing Primer
(F):5'- ACACATTCCTGGAAGGCGTTC -3'
(R):5'- ATCAAGAGTGGCTGACGGTGTG -3'
Posted On 2016-10-05