Mutagenetix > Incidental Mutation

Incidental Mutation 'R5516:Adgb'

431297

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

043075-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10431157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 334 (K334R)

Ref Sequence

ENSEMBL: ENSMUSP00000136386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000045328

SMART Domains

Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	11	257	1e-165	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000132573
AA Change: K361R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: K361R

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: K361R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: K361R

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179956
AA Change: K334R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: K334R

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208717
AA Change: K355R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.4%

Validation Efficiency

97% (58/60)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l1	A	T	6: 90,596,945	I809F	possibly damaging	Het
Bmp2k	T	A	5: 97,087,453		probably benign	Het
C1qtnf9	T	A	14: 60,779,749	C243S	probably damaging	Het
Cacna1c	G	A	6: 119,057,218	A146V	probably damaging	Het
Ccdc85c	A	G	12: 108,207,850	V353A	probably damaging	Het
Cd300ld2	G	T	11: 115,012,444		probably benign	Het
Cd320	A	G	17: 33,848,047	Q170R	possibly damaging	Het
Cfap43	C	T	19: 47,738,209		probably null	Het
Chid1	A	G	7: 141,496,146	S365P	probably damaging	Het
Chrna7	T	G	7: 63,099,298	T479P	probably damaging	Het
Clasp1	G	T	1: 118,497,721	R35L	probably damaging	Het
Cluh	G	A	11: 74,660,444	R373H	probably damaging	Het
Cyp2b23	G	A	7: 26,673,057	R378*	probably null	Het
Cyp2d9	T	G	15: 82,454,327	N136K	probably null	Het
Efcab5	A	T	11: 77,188,789	S44T	possibly damaging	Het
Esrrg	A	T	1: 188,198,730	L316F	possibly damaging	Het
Fam222a	T	C	5: 114,611,828	Y362H	probably damaging	Het
Fat3	A	G	9: 15,998,709	V1999A	probably damaging	Het
Fes	A	T	7: 80,387,183	M51K	probably damaging	Het
Fmo3	T	A	1: 162,954,426	K453*	probably null	Het
Galnt1	A	G	18: 24,280,017	N458S	probably benign	Het
Gm13083	A	G	4: 143,615,683	Q120R	possibly damaging	Het
Gm8888	T	A	15: 96,766,974		noncoding transcript	Het
Gpn2	G	A	4: 133,584,879		probably null	Het
Grm4	G	A	17: 27,438,411	T464I	probably benign	Het
Insr	T	A	8: 3,155,764	K1342*	probably null	Het
Krt83	T	A	15: 101,487,121	K365*	probably null	Het
Lfng	T	C	5: 140,613,263	L309P	probably damaging	Het
Lnpk	T	C	2: 74,547,788		probably benign	Het
Lrrc8e	A	C	8: 4,235,818	D681A	probably damaging	Het
Lyst	G	A	13: 13,644,122	D1326N	probably benign	Het
Mmp27	A	G	9: 7,579,062	R413G	probably null	Het
Nags	C	T	11: 102,145,947	Q121*	probably null	Het
Nectin1	A	G	9: 43,803,793	E442G	probably benign	Het
Nek1	G	C	8: 61,089,489	A729P	probably benign	Het
Olfr645	A	G	7: 104,084,237	I281T	possibly damaging	Het
Pnp2	C	T	14: 50,963,738	A189V	probably benign	Het
Ppm1m	T	A	9: 106,197,939	I136F	probably damaging	Het
Psg17	G	T	7: 18,814,533	Q438K	probably benign	Het
Ptprk	C	T	10: 28,496,930	R726*	probably null	Het
Rab3gap2	A	T	1: 185,235,487	Y163F	probably benign	Het
Scrib	A	T	15: 76,062,863	L627Q	possibly damaging	Het
Tcp1	A	G	17: 12,924,334	K510R	probably damaging	Het
Tle4	A	T	19: 14,454,889	I481N	probably damaging	Het
Tmem43	G	T	6: 91,478,210	R56L	possibly damaging	Het
Trmt10a	T	C	3: 138,152,196	I168T	possibly damaging	Het
Trpv1	A	T	11: 73,245,983	Y96F	probably benign	Het
Tshz3	C	T	7: 36,770,350	T588I	probably benign	Het
Ugt2b38	A	G	5: 87,411,843	F397L	probably damaging	Het
Vmn2r11	A	G	5: 109,047,166	S765P	probably damaging	Het
Zfp668	A	G	7: 127,867,146	F289L	probably damaging	Het
Zfp735	A	G	11: 73,710,814	T195A	probably benign	Het
Zscan10	A	G	17: 23,609,359	T182A	possibly damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGGCGTGACAAGACACATTG -3'
(R):5'- AGAGCCCAGTTCTGAAAGC -3'

Sequencing Primer
(F):5'- CGTGACAAGACACATTGAGAGTTC -3'
(R):5'- GAGCCCAGTTCTGAAAGCAAAATC -3'

Posted On

2016-10-05