Incidental Mutation 'R5516:Adgb'
ID431297
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 043075-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10431157 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 334 (K334R)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000045328
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
AA Change: K361R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: K361R

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: K361R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: K361R

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179956
AA Change: K334R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: K334R

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208717
AA Change: K355R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 intron probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGCGTGACAAGACACATTG -3'
(R):5'- AGAGCCCAGTTCTGAAAGC -3'

Sequencing Primer
(F):5'- CGTGACAAGACACATTGAGAGTTC -3'
(R):5'- GAGCCCAGTTCTGAAAGCAAAATC -3'
Posted On2016-10-05