Mutagenetix > Incidental Mutations

Incidental Mutation 'R5516:Cluh'

431301

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

043075-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R5516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74660444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 373 (R373H)

Ref Sequence

ENSEMBL: ENSMUSP00000113371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000092915
AA Change: R373H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: R373H

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117818
AA Change: R373H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: R373H

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128155

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130398

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155558

Meta Mutation Damage Score

0.4321

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.4%

Validation Efficiency

97% (58/60)

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	C	10: 10,431,157	K334R	probably damaging	Het
Aldh1l1	A	T	6: 90,596,945	I809F	possibly damaging	Het
Bmp2k	T	A	5: 97,087,453		probably benign	Het
C1qtnf9	T	A	14: 60,779,749	C243S	probably damaging	Het
Cacna1c	G	A	6: 119,057,218	A146V	probably damaging	Het
Ccdc85c	A	G	12: 108,207,850	V353A	probably damaging	Het
Cd300ld2	G	T	11: 115,012,444		probably benign	Het
Cd320	A	G	17: 33,848,047	Q170R	possibly damaging	Het
Cfap43	C	T	19: 47,738,209		probably null	Het
Chid1	A	G	7: 141,496,146	S365P	probably damaging	Het
Chrna7	T	G	7: 63,099,298	T479P	probably damaging	Het
Clasp1	G	T	1: 118,497,721	R35L	probably damaging	Het
Cyp2b23	G	A	7: 26,673,057	R378*	probably null	Het
Cyp2d9	T	G	15: 82,454,327	N136K	probably null	Het
Efcab5	A	T	11: 77,188,789	S44T	possibly damaging	Het
Esrrg	A	T	1: 188,198,730	L316F	possibly damaging	Het
Fam222a	T	C	5: 114,611,828	Y362H	probably damaging	Het
Fat3	A	G	9: 15,998,709	V1999A	probably damaging	Het
Fes	A	T	7: 80,387,183	M51K	probably damaging	Het
Fmo3	T	A	1: 162,954,426	K453*	probably null	Het
Galnt1	A	G	18: 24,280,017	N458S	probably benign	Het
Gm13083	A	G	4: 143,615,683	Q120R	possibly damaging	Het
Gm8888	T	A	15: 96,766,974		noncoding transcript	Het
Gpn2	G	A	4: 133,584,879		probably null	Het
Grm4	G	A	17: 27,438,411	T464I	probably benign	Het
Insr	T	A	8: 3,155,764	K1342*	probably null	Het
Krt83	T	A	15: 101,487,121	K365*	probably null	Het
Lfng	T	C	5: 140,613,263	L309P	probably damaging	Het
Lnpk	T	C	2: 74,547,788		probably benign	Het
Lrrc8e	A	C	8: 4,235,818	D681A	probably damaging	Het
Lyst	G	A	13: 13,644,122	D1326N	probably benign	Het
Mmp27	A	G	9: 7,579,062	R413G	probably null	Het
Nags	C	T	11: 102,145,947	Q121*	probably null	Het
Nectin1	A	G	9: 43,803,793	E442G	probably benign	Het
Nek1	G	C	8: 61,089,489	A729P	probably benign	Het
Olfr645	A	G	7: 104,084,237	I281T	possibly damaging	Het
Pnp2	C	T	14: 50,963,738	A189V	probably benign	Het
Ppm1m	T	A	9: 106,197,939	I136F	probably damaging	Het
Psg17	G	T	7: 18,814,533	Q438K	probably benign	Het
Ptprk	C	T	10: 28,496,930	R726*	probably null	Het
Rab3gap2	A	T	1: 185,235,487	Y163F	probably benign	Het
Scrib	A	T	15: 76,062,863	L627Q	possibly damaging	Het
Tcp1	A	G	17: 12,924,334	K510R	probably damaging	Het
Tle4	A	T	19: 14,454,889	I481N	probably damaging	Het
Tmem43	G	T	6: 91,478,210	R56L	possibly damaging	Het
Trmt10a	T	C	3: 138,152,196	I168T	possibly damaging	Het
Trpv1	A	T	11: 73,245,983	Y96F	probably benign	Het
Tshz3	C	T	7: 36,770,350	T588I	probably benign	Het
Ugt2b38	A	G	5: 87,411,843	F397L	probably damaging	Het
Vmn2r11	A	G	5: 109,047,166	S765P	probably damaging	Het
Zfp668	A	G	7: 127,867,146	F289L	probably damaging	Het
Zfp735	A	G	11: 73,710,814	T195A	probably benign	Het
Zscan10	A	G	17: 23,609,359	T182A	possibly damaging	Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6541:Cluh	UTSW	11	74657214	missense	probably damaging	1.00
R6674:Cluh	UTSW	11	74666227	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R6875:Cluh	UTSW	11	74661918	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7225:Cluh	UTSW	11	74666406	splice site	probably null
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9061:Cluh	UTSW	11	74660366	missense	possibly damaging	0.73
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACTTCTGGTTGGCATCCATG -3'
(R):5'- ATGTCTGCTGACCTGCTCTG -3'

Sequencing Primer
(F):5'- CATCCATGGGTAGGAGATGCC -3'
(R):5'- GCTGACCTGCTCTGGGTTATC -3'

Posted On

2016-10-05