Incidental Mutation 'R5516:Ccdc85c'
ID431305
Institutional Source Beutler Lab
Gene Symbol Ccdc85c
Ensembl Gene ENSMUSG00000084883
Gene Namecoiled-coil domain containing 85C
SynonymsGm9010
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R5516 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108203602-108275425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108207850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 353 (V353A)
Ref Sequence ENSEMBL: ENSMUSP00000152421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101055] [ENSMUST00000136175] [ENSMUST00000221167] [ENSMUST00000222310]
Predicted Effect probably benign
Transcript: ENSMUST00000101055
SMART Domains Protein: ENSMUSP00000098616
Gene: ENSMUSG00000021258

DomainStartEndE-ValueType
CYCLIN 55 149 6.67e-16 SMART
Cyclin_C 158 278 4.83e-1 SMART
CYCLIN 162 256 1.23e-1 SMART
low complexity region 342 361 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
low complexity region 404 427 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 476 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136175
AA Change: V366A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125757
Gene: ENSMUSG00000084883
AA Change: V366A

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:DUF2216 16 220 6.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221167
Predicted Effect probably damaging
Transcript: ENSMUST00000222310
AA Change: V353A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1914 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygous mutant mice display hydrocephalus, intracranial hemorrhage due to ventricular dilatation, and heterotopia in the subcortical regions. Hydroencephaly usually becomes evident before 15 weeks of age and affected animals die within several days after notice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Ccdc85c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccdc85c APN 12 108207844 missense probably damaging 1.00
IGL02061:Ccdc85c APN 12 108221743 missense probably damaging 1.00
IGL02316:Ccdc85c APN 12 108211570 missense probably damaging 1.00
IGL02516:Ccdc85c APN 12 108274901 missense unknown
IGL03146:Ccdc85c APN 12 108207136 nonsense probably null
FR4304:Ccdc85c UTSW 12 108274612 small insertion probably benign
FR4449:Ccdc85c UTSW 12 108274616 small insertion probably benign
R4685:Ccdc85c UTSW 12 108207175 missense probably benign 0.33
R5048:Ccdc85c UTSW 12 108221707 critical splice donor site probably null
R5588:Ccdc85c UTSW 12 108211534 missense probably damaging 1.00
R6054:Ccdc85c UTSW 12 108274769 missense unknown
R6318:Ccdc85c UTSW 12 108274709 missense unknown
R7094:Ccdc85c UTSW 12 108274618 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGTTCCCTCAGCAGCAAC -3'
(R):5'- TGGTGTTCATCCAGTGACAG -3'

Sequencing Primer
(F):5'- TGACGAGCCCAAGACTACATTCAG -3'
(R):5'- TTCATCCAGTGACAGGTGTCCAG -3'
Posted On2016-10-05