Incidental Mutation 'R5516:Pnp2'
ID 431307
Institutional Source Beutler Lab
Gene Symbol Pnp2
Ensembl Gene ENSMUSG00000068417
Gene Name purine-nucleoside phosphorylase 2
Synonyms
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R5516 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50955992-50964749 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 50963738 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 189 (A189V)
Ref Sequence ENSEMBL: ENSMUSP00000093615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000227052]
AlphaFold Q9D8C9
Predicted Effect probably benign
Transcript: ENSMUST00000095925
AA Change: A189V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417
AA Change: A189V

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178092
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228593
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Galnt1 A G 18: 24,280,017 N458S probably benign Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Pnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Pnp2 APN 14 50959553 missense probably damaging 1.00
IGL02418:Pnp2 APN 14 50963836 missense possibly damaging 0.51
IGL03216:Pnp2 APN 14 50963197 missense probably benign 0.01
IGL03388:Pnp2 APN 14 50963538 missense probably damaging 1.00
R0049:Pnp2 UTSW 14 50959533 nonsense probably null
R0097:Pnp2 UTSW 14 50963501 missense probably benign 0.08
R0123:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0134:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0158:Pnp2 UTSW 14 50964304 missense probably damaging 1.00
R1477:Pnp2 UTSW 14 50959535 missense probably benign 0.35
R1820:Pnp2 UTSW 14 50964457 missense possibly damaging 0.93
R1934:Pnp2 UTSW 14 50956218 missense probably benign
R2138:Pnp2 UTSW 14 50963704 missense probably damaging 1.00
R3843:Pnp2 UTSW 14 50963421 missense probably null 1.00
R4355:Pnp2 UTSW 14 50959625 missense probably benign
R4938:Pnp2 UTSW 14 50963568 splice site probably null
R5636:Pnp2 UTSW 14 50956192 splice site probably null
R6396:Pnp2 UTSW 14 50963159 missense probably damaging 1.00
R7117:Pnp2 UTSW 14 50964474 makesense probably null
R7862:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R7934:Pnp2 UTSW 14 50964446 missense probably benign 0.00
R8057:Pnp2 UTSW 14 50964381 missense probably benign 0.06
R8104:Pnp2 UTSW 14 50959642 missense probably benign 0.00
R8488:Pnp2 UTSW 14 50964379 missense possibly damaging 0.79
R8519:Pnp2 UTSW 14 50964385 missense probably damaging 1.00
R8791:Pnp2 UTSW 14 50963416 missense probably benign 0.00
R8916:Pnp2 UTSW 14 50963777 missense probably damaging 1.00
R9592:Pnp2 UTSW 14 50959522 missense probably damaging 0.99
R9592:Pnp2 UTSW 14 50959524 nonsense probably null
R9762:Pnp2 UTSW 14 50959549 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCCAACGATGAAAGGTAC -3'
(R):5'- GCTCAAGCCTGTTGTCTCTG -3'

Sequencing Primer
(F):5'- GAAAGGTACACATCTTTGATCCC -3'
(R):5'- AAGCCTGTTGTCTCTGCTTTCCTAG -3'
Posted On 2016-10-05