Incidental Mutation 'R5516:Galnt1'
ID 431317
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Name polypeptide N-acetylgalactosaminyltransferase 1
Synonyms ppGaNTase-T1
MMRRC Submission 043075-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock # R5516 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 24205344-24286818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24280017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 458 (N458S)
Ref Sequence ENSEMBL: ENSMUSP00000137427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000170243] [ENSMUST00000178605]
AlphaFold O08912
Predicted Effect probably benign
Transcript: ENSMUST00000000430
AA Change: N458S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: N458S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170191
Predicted Effect probably benign
Transcript: ENSMUST00000170243
AA Change: N458S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: N458S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178605
AA Change: N458S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: N458S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,431,157 K334R probably damaging Het
Aldh1l1 A T 6: 90,596,945 I809F possibly damaging Het
Bmp2k T A 5: 97,087,453 probably benign Het
C1qtnf9 T A 14: 60,779,749 C243S probably damaging Het
Cacna1c G A 6: 119,057,218 A146V probably damaging Het
Ccdc85c A G 12: 108,207,850 V353A probably damaging Het
Cd300ld2 G T 11: 115,012,444 probably benign Het
Cd320 A G 17: 33,848,047 Q170R possibly damaging Het
Cfap43 C T 19: 47,738,209 probably null Het
Chid1 A G 7: 141,496,146 S365P probably damaging Het
Chrna7 T G 7: 63,099,298 T479P probably damaging Het
Clasp1 G T 1: 118,497,721 R35L probably damaging Het
Cluh G A 11: 74,660,444 R373H probably damaging Het
Cyp2b23 G A 7: 26,673,057 R378* probably null Het
Cyp2d9 T G 15: 82,454,327 N136K probably null Het
Efcab5 A T 11: 77,188,789 S44T possibly damaging Het
Esrrg A T 1: 188,198,730 L316F possibly damaging Het
Fam222a T C 5: 114,611,828 Y362H probably damaging Het
Fat3 A G 9: 15,998,709 V1999A probably damaging Het
Fes A T 7: 80,387,183 M51K probably damaging Het
Fmo3 T A 1: 162,954,426 K453* probably null Het
Gm13083 A G 4: 143,615,683 Q120R possibly damaging Het
Gm8888 T A 15: 96,766,974 noncoding transcript Het
Gpn2 G A 4: 133,584,879 probably null Het
Grm4 G A 17: 27,438,411 T464I probably benign Het
Insr T A 8: 3,155,764 K1342* probably null Het
Krt83 T A 15: 101,487,121 K365* probably null Het
Lfng T C 5: 140,613,263 L309P probably damaging Het
Lnpk T C 2: 74,547,788 probably benign Het
Lrrc8e A C 8: 4,235,818 D681A probably damaging Het
Lyst G A 13: 13,644,122 D1326N probably benign Het
Mmp27 A G 9: 7,579,062 R413G probably null Het
Nags C T 11: 102,145,947 Q121* probably null Het
Nectin1 A G 9: 43,803,793 E442G probably benign Het
Nek1 G C 8: 61,089,489 A729P probably benign Het
Olfr645 A G 7: 104,084,237 I281T possibly damaging Het
Pnp2 C T 14: 50,963,738 A189V probably benign Het
Ppm1m T A 9: 106,197,939 I136F probably damaging Het
Psg17 G T 7: 18,814,533 Q438K probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rab3gap2 A T 1: 185,235,487 Y163F probably benign Het
Scrib A T 15: 76,062,863 L627Q possibly damaging Het
Tcp1 A G 17: 12,924,334 K510R probably damaging Het
Tle4 A T 19: 14,454,889 I481N probably damaging Het
Tmem43 G T 6: 91,478,210 R56L possibly damaging Het
Trmt10a T C 3: 138,152,196 I168T possibly damaging Het
Trpv1 A T 11: 73,245,983 Y96F probably benign Het
Tshz3 C T 7: 36,770,350 T588I probably benign Het
Ugt2b38 A G 5: 87,411,843 F397L probably damaging Het
Vmn2r11 A G 5: 109,047,166 S765P probably damaging Het
Zfp668 A G 7: 127,867,146 F289L probably damaging Het
Zfp735 A G 11: 73,710,814 T195A probably benign Het
Zscan10 A G 17: 23,609,359 T182A possibly damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24267560 missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24280035 missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24264412 missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24269517 missense probably damaging 0.99
debonair UTSW 18 24271629 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24254525 missense probably benign 0.01
R1183:Galnt1 UTSW 18 24271590 missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24271774 splice site probably benign
R2349:Galnt1 UTSW 18 24280028 missense probably benign 0.03
R3739:Galnt1 UTSW 18 24271655 missense probably benign 0.27
R4223:Galnt1 UTSW 18 24238356 missense probably benign 0.27
R5001:Galnt1 UTSW 18 24271755 missense probably benign
R5410:Galnt1 UTSW 18 24267547 missense probably benign 0.02
R5685:Galnt1 UTSW 18 24264529 missense possibly damaging 0.81
R5687:Galnt1 UTSW 18 24272750 missense probably benign 0.00
R5735:Galnt1 UTSW 18 24264520 missense possibly damaging 0.64
R6106:Galnt1 UTSW 18 24254663 missense probably benign 0.31
R6222:Galnt1 UTSW 18 24264534 critical splice donor site probably null
R7448:Galnt1 UTSW 18 24284809 missense probably benign 0.00
R7489:Galnt1 UTSW 18 24282157 missense probably damaging 0.98
R8310:Galnt1 UTSW 18 24271629 missense probably damaging 1.00
R8408:Galnt1 UTSW 18 24267571 missense probably benign 0.44
R8884:Galnt1 UTSW 18 24267584 missense probably benign 0.00
R8989:Galnt1 UTSW 18 24269510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGTGTCCTTGAGTTGCTTTATTACTCA -3'
(R):5'- AAGTACCCTTCACCTAATACTCATTT -3'

Sequencing Primer
(F):5'- ATCACTTGGGGCTGAACATC -3'
(R):5'- TGTTATGGGATTAAAAGAGCA -3'
Posted On 2016-10-05