Incidental Mutation 'R5517:Map2'
ID 431320
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Name microtubule-associated protein 2
Synonyms G1-397-34, MAP-2, Mtap2, repro4
MMRRC Submission 043076-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.679) question?
Stock # R5517 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 66214432-66481742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66454415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1102 (S1102P)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000172886] [ENSMUST00000173800] [ENSMUST00000173855] [ENSMUST00000173778] [ENSMUST00000145419]
AlphaFold P20357
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
AA Change: S1102P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: S1102P

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,269,233 (GRCm39) R675K possibly damaging Het
Aire A T 10: 77,875,525 (GRCm39) S282T probably benign Het
Ak9 A G 10: 41,216,887 (GRCm39) E283G probably benign Het
Akap9 T A 5: 4,051,665 (GRCm39) D1477E possibly damaging Het
Ap2a1 T C 7: 44,556,405 (GRCm39) D273G possibly damaging Het
Apob T C 12: 8,040,906 (GRCm39) L664P probably damaging Het
Arhgap35 A T 7: 16,297,414 (GRCm39) F550L probably damaging Het
Armc2 T C 10: 41,839,846 (GRCm39) E373G probably benign Het
Atp8b2 C A 3: 89,853,338 (GRCm39) A726S probably benign Het
C030048H21Rik T A 2: 26,145,899 (GRCm39) Q87L probably damaging Het
Cd244a T A 1: 171,405,542 (GRCm39) probably benign Het
Cdk10 T A 8: 123,957,326 (GRCm39) probably null Het
Cenpe C A 3: 134,929,026 (GRCm39) P310Q probably damaging Het
Chuk T A 19: 44,085,972 (GRCm39) probably null Het
Crebl2 T C 6: 134,828,139 (GRCm39) S104P probably benign Het
Ddo A G 10: 40,523,726 (GRCm39) K239E probably benign Het
Defb5 A G 8: 19,300,868 (GRCm39) probably null Het
Dhx35 T A 2: 158,676,832 (GRCm39) M422K probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Gatm G A 2: 122,426,024 (GRCm39) T409I probably damaging Het
Gdpd1 A T 11: 86,950,332 (GRCm39) D80E probably damaging Het
Gspt1 C A 16: 11,071,843 (GRCm39) G7C unknown Het
Hells G A 19: 38,943,244 (GRCm39) S516N probably benign Het
Ints1 A G 5: 139,738,542 (GRCm39) S2069P possibly damaging Het
Kank4 G A 4: 98,663,118 (GRCm39) T690M probably damaging Het
Kcnq4 T C 4: 120,573,006 (GRCm39) N265S possibly damaging Het
Kif5b C A 18: 6,220,954 (GRCm39) A385S probably benign Het
Mcm7 A G 5: 138,163,133 (GRCm39) S340P possibly damaging Het
Mcrs1 C T 15: 99,144,876 (GRCm39) R246H possibly damaging Het
Myo16 T A 8: 10,610,226 (GRCm39) M1189K probably benign Het
Or4d2 A T 11: 87,783,892 (GRCm39) I286N probably damaging Het
Or4k52 G T 2: 111,610,804 (GRCm39) M46I probably benign Het
Or7g29 G A 9: 19,287,063 (GRCm39) T38I probably damaging Het
Otog A G 7: 45,923,995 (GRCm39) N1118S probably damaging Het
Pakap T C 4: 57,855,987 (GRCm39) Y439H probably damaging Het
Pcdhb7 G T 18: 37,474,846 (GRCm39) probably benign Het
Picalm C T 7: 89,819,806 (GRCm39) T189I possibly damaging Het
Ptx4 T A 17: 25,343,760 (GRCm39) S337T possibly damaging Het
Rad51ap2 C T 12: 11,508,313 (GRCm39) S745L probably benign Het
Rspry1 G A 8: 95,363,388 (GRCm39) probably null Het
Scn5a T G 9: 119,324,779 (GRCm39) I1350L probably damaging Het
Sgk2 T C 2: 162,839,755 (GRCm39) L121P probably damaging Het
Slc17a1 A T 13: 24,056,575 (GRCm39) probably benign Het
Slc6a12 A G 6: 121,331,298 (GRCm39) N183S probably benign Het
Smg9 C A 7: 24,114,338 (GRCm39) probably benign Het
Spred1 G A 2: 117,008,195 (GRCm39) S367N probably damaging Het
Srpra T C 9: 35,122,646 (GRCm39) V21A probably benign Het
Taar2 A T 10: 23,816,627 (GRCm39) I56F possibly damaging Het
Taf1a T G 1: 183,177,323 (GRCm39) L67R probably damaging Het
Tbc1d10b C A 7: 126,797,779 (GRCm39) R787S possibly damaging Het
Topbp1 T A 9: 103,213,313 (GRCm39) N1044K probably benign Het
Usp24 A G 4: 106,232,871 (GRCm39) T886A probably benign Het
Vmn2r26 A G 6: 124,027,676 (GRCm39) D472G probably damaging Het
Zyg11a T C 4: 108,061,943 (GRCm39) N286S possibly damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66,464,490 (GRCm39) missense probably damaging 1.00
IGL02135:Map2 APN 1 66,419,920 (GRCm39) nonsense probably null
IGL02526:Map2 APN 1 66,419,876 (GRCm39) missense possibly damaging 0.94
Annas UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
calliope UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
carthage UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
costas UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
Jacobin UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
Nectar UTSW 1 66,454,522 (GRCm39) nonsense probably null
ruby_throat UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
Rufous UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
Speckled UTSW 1 66,451,886 (GRCm39) nonsense probably null
Sunbird UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
swift UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
E0370:Map2 UTSW 1 66,455,883 (GRCm39) unclassified probably benign
PIT4362001:Map2 UTSW 1 66,451,677 (GRCm39) missense probably benign 0.05
R0067:Map2 UTSW 1 66,452,322 (GRCm39) missense probably benign 0.04
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0268:Map2 UTSW 1 66,419,881 (GRCm39) nonsense probably null
R0302:Map2 UTSW 1 66,453,987 (GRCm39) missense probably benign 0.15
R0305:Map2 UTSW 1 66,452,253 (GRCm39) missense probably benign 0.00
R0409:Map2 UTSW 1 66,472,739 (GRCm39) missense probably damaging 1.00
R0561:Map2 UTSW 1 66,464,656 (GRCm39) missense probably damaging 1.00
R0674:Map2 UTSW 1 66,452,361 (GRCm39) missense probably damaging 1.00
R0738:Map2 UTSW 1 66,464,348 (GRCm39) splice site probably benign
R0893:Map2 UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
R1305:Map2 UTSW 1 66,464,554 (GRCm39) missense probably damaging 1.00
R1534:Map2 UTSW 1 66,452,339 (GRCm39) missense probably benign 0.33
R1632:Map2 UTSW 1 66,454,245 (GRCm39) missense possibly damaging 0.60
R1682:Map2 UTSW 1 66,454,781 (GRCm39) splice site probably null
R1774:Map2 UTSW 1 66,453,233 (GRCm39) missense probably damaging 1.00
R2014:Map2 UTSW 1 66,455,295 (GRCm39) missense possibly damaging 0.55
R2017:Map2 UTSW 1 66,451,958 (GRCm39) missense probably damaging 1.00
R2050:Map2 UTSW 1 66,453,473 (GRCm39) missense probably damaging 0.98
R2093:Map2 UTSW 1 66,438,599 (GRCm39) missense probably damaging 1.00
R2214:Map2 UTSW 1 66,459,345 (GRCm39) missense probably damaging 0.99
R2284:Map2 UTSW 1 66,453,227 (GRCm39) missense probably damaging 1.00
R3011:Map2 UTSW 1 66,453,771 (GRCm39) missense probably damaging 1.00
R3105:Map2 UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
R3708:Map2 UTSW 1 66,455,714 (GRCm39) unclassified probably benign
R3709:Map2 UTSW 1 66,455,015 (GRCm39) nonsense probably null
R3729:Map2 UTSW 1 66,451,605 (GRCm39) missense possibly damaging 0.80
R3760:Map2 UTSW 1 66,478,077 (GRCm39) missense probably damaging 1.00
R3788:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R3789:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R4003:Map2 UTSW 1 66,454,899 (GRCm39) missense probably damaging 1.00
R4120:Map2 UTSW 1 66,455,063 (GRCm39) missense probably damaging 1.00
R4172:Map2 UTSW 1 66,452,759 (GRCm39) missense possibly damaging 0.89
R4198:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4200:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4205:Map2 UTSW 1 66,464,449 (GRCm39) missense probably damaging 1.00
R4613:Map2 UTSW 1 66,464,628 (GRCm39) missense probably damaging 1.00
R4700:Map2 UTSW 1 66,449,796 (GRCm39) missense probably damaging 0.96
R4974:Map2 UTSW 1 66,452,664 (GRCm39) missense probably benign 0.15
R5007:Map2 UTSW 1 66,452,448 (GRCm39) missense possibly damaging 0.86
R5039:Map2 UTSW 1 66,477,955 (GRCm39) missense probably damaging 1.00
R5237:Map2 UTSW 1 66,478,169 (GRCm39) unclassified probably benign
R5313:Map2 UTSW 1 66,464,538 (GRCm39) missense probably damaging 1.00
R5455:Map2 UTSW 1 66,438,550 (GRCm39) missense probably damaging 1.00
R5490:Map2 UTSW 1 66,452,292 (GRCm39) missense probably damaging 1.00
R5532:Map2 UTSW 1 66,453,779 (GRCm39) missense probably damaging 1.00
R5583:Map2 UTSW 1 66,455,196 (GRCm39) missense probably damaging 1.00
R5764:Map2 UTSW 1 66,454,034 (GRCm39) missense probably damaging 0.99
R5996:Map2 UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
R6058:Map2 UTSW 1 66,454,573 (GRCm39) missense probably benign 0.05
R6199:Map2 UTSW 1 66,464,637 (GRCm39) missense probably damaging 1.00
R6208:Map2 UTSW 1 66,470,749 (GRCm39) missense probably damaging 1.00
R6276:Map2 UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
R6378:Map2 UTSW 1 66,454,488 (GRCm39) missense probably damaging 1.00
R6424:Map2 UTSW 1 66,453,946 (GRCm39) missense possibly damaging 0.67
R6743:Map2 UTSW 1 66,454,766 (GRCm39) missense probably benign 0.04
R6837:Map2 UTSW 1 66,453,731 (GRCm39) missense probably damaging 1.00
R6901:Map2 UTSW 1 66,460,932 (GRCm39) missense possibly damaging 0.94
R6984:Map2 UTSW 1 66,454,395 (GRCm39) missense possibly damaging 0.90
R6989:Map2 UTSW 1 66,454,065 (GRCm39) missense probably benign 0.00
R7001:Map2 UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
R7055:Map2 UTSW 1 66,455,983 (GRCm39) missense probably damaging 1.00
R7094:Map2 UTSW 1 66,451,886 (GRCm39) nonsense probably null
R7106:Map2 UTSW 1 66,449,903 (GRCm39) missense possibly damaging 0.92
R7182:Map2 UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
R7235:Map2 UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
R7424:Map2 UTSW 1 66,453,983 (GRCm39) missense possibly damaging 0.69
R7473:Map2 UTSW 1 66,454,617 (GRCm39) missense probably damaging 1.00
R7642:Map2 UTSW 1 66,452,466 (GRCm39) missense probably benign 0.01
R7660:Map2 UTSW 1 66,453,536 (GRCm39) missense probably damaging 1.00
R7673:Map2 UTSW 1 66,452,933 (GRCm39) missense probably benign 0.03
R7768:Map2 UTSW 1 66,453,642 (GRCm39) missense possibly damaging 0.94
R7796:Map2 UTSW 1 66,455,654 (GRCm39) splice site probably null
R7834:Map2 UTSW 1 66,455,647 (GRCm39) missense probably damaging 1.00
R7842:Map2 UTSW 1 66,455,570 (GRCm39) missense probably benign
R7955:Map2 UTSW 1 66,452,875 (GRCm39) missense probably damaging 1.00
R8056:Map2 UTSW 1 66,454,779 (GRCm39) missense probably damaging 0.99
R8118:Map2 UTSW 1 66,464,550 (GRCm39) missense probably damaging 1.00
R8135:Map2 UTSW 1 66,452,828 (GRCm39) missense probably damaging 1.00
R8152:Map2 UTSW 1 66,453,902 (GRCm39) missense probably benign 0.00
R8223:Map2 UTSW 1 66,464,649 (GRCm39) missense probably damaging 1.00
R8329:Map2 UTSW 1 66,454,272 (GRCm39) missense probably benign 0.01
R8344:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8475:Map2 UTSW 1 66,453,164 (GRCm39) missense probably damaging 1.00
R8548:Map2 UTSW 1 66,452,499 (GRCm39) missense probably damaging 1.00
R8680:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8713:Map2 UTSW 1 66,453,781 (GRCm39) missense probably damaging 1.00
R8745:Map2 UTSW 1 66,452,556 (GRCm39) missense probably benign 0.00
R8786:Map2 UTSW 1 66,472,755 (GRCm39) critical splice donor site probably benign
R8790:Map2 UTSW 1 66,477,997 (GRCm39) missense probably damaging 1.00
R8874:Map2 UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
R8887:Map2 UTSW 1 66,454,758 (GRCm39) missense possibly damaging 0.48
R8948:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8950:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8998:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R8999:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R9072:Map2 UTSW 1 66,453,312 (GRCm39) missense probably damaging 1.00
R9088:Map2 UTSW 1 66,453,773 (GRCm39) missense probably damaging 1.00
R9089:Map2 UTSW 1 66,452,098 (GRCm39) missense probably benign 0.09
R9106:Map2 UTSW 1 66,454,522 (GRCm39) nonsense probably null
R9112:Map2 UTSW 1 66,472,723 (GRCm39) nonsense probably null
R9120:Map2 UTSW 1 66,453,218 (GRCm39) missense probably damaging 1.00
R9161:Map2 UTSW 1 66,477,503 (GRCm39) missense possibly damaging 0.65
R9464:Map2 UTSW 1 66,454,497 (GRCm39) missense probably damaging 1.00
R9589:Map2 UTSW 1 66,449,753 (GRCm39) missense probably benign
V8831:Map2 UTSW 1 66,455,004 (GRCm39) missense probably damaging 1.00
Z1177:Map2 UTSW 1 66,477,520 (GRCm39) missense probably damaging 0.96
Z1177:Map2 UTSW 1 66,419,839 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGAAAGCTGAGCCAAGTC -3'
(R):5'- TACAGACAGCTTGAGGGCAAC -3'

Sequencing Primer
(F):5'- AGCTGAGCCAAGTCAGTTAG -3'
(R):5'- AGGGCAACTTCATCTTGGATCAG -3'
Posted On 2016-10-05