Incidental Mutation 'R5517:Cd244'
ID 431321
Institutional Source Beutler Lab
Gene Symbol Cd244
Ensembl Gene ENSMUSG00000004709
Gene Name CD244 natural killer cell receptor 2B4
Synonyms 2B4, C9.1, F730046O15Rik, Nmrk
MMRRC Submission 043076-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R5517 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171559193-171609746 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 171577974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004829] [ENSMUST00000194797]
AlphaFold Q07763
Predicted Effect probably benign
Transcript: ENSMUST00000004829
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194170
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195804
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered natural killer (NK) cell cytolysis. Mice homozygous for an ENU-generated allele exhibit reduced 'missing-self' targets recognition and elimination and increased clearance of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Cd244
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cd244 APN 1 171574370 critical splice donor site probably null
IGL01014:Cd244 APN 1 171574288 missense probably damaging 1.00
IGL01689:Cd244 APN 1 171582894 intron probably benign
IGL02327:Cd244 APN 1 171559341 missense probably benign 0.36
R0022:Cd244 UTSW 1 171573762 missense probably benign 0.03
R0930:Cd244 UTSW 1 171577233 splice site probably null
R1055:Cd244 UTSW 1 171577276 missense probably damaging 0.99
R4587:Cd244 UTSW 1 171577879 missense probably benign 0.05
R5929:Cd244 UTSW 1 171559367 missense probably damaging 1.00
R5996:Cd244 UTSW 1 171581640 splice site probably null
R6346:Cd244 UTSW 1 171577321 missense probably damaging 1.00
R6502:Cd244 UTSW 1 171577879 missense probably benign 0.05
R6612:Cd244 UTSW 1 171574104 missense probably benign 0.05
R6701:Cd244 UTSW 1 171574155 missense possibly damaging 0.67
R6973:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R7655:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7656:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7672:Cd244 UTSW 1 171577285 missense probably benign 0.28
R7769:Cd244 UTSW 1 171577305 missense probably benign 0.24
R8910:Cd244 UTSW 1 171559373 missense probably damaging 0.96
R8913:Cd244 UTSW 1 171574206 missense probably damaging 1.00
R8913:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R9274:Cd244 UTSW 1 171574360 missense probably benign 0.03
RF004:Cd244 UTSW 1 171577922 missense probably benign 0.15
Z1177:Cd244 UTSW 1 171574350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTCTTCCTCACACAGAGTTCAG -3'
(R):5'- AAGGAAAGCTGGCCCTGAAC -3'

Sequencing Primer
(F):5'- GAGTTCAGCCCTAAGGAACCTTTG -3'
(R):5'- CTGGCCCTGAACGGTTTCTATAAG -3'
Posted On 2016-10-05