Incidental Mutation 'R5517:Or4k52'
ID 431324
Institutional Source Beutler Lab
Gene Symbol Or4k52
Ensembl Gene ENSMUSG00000044560
Gene Name olfactory receptor family 4 subfamily K member 52
Synonyms Olfr1302, GA_x6K02T2Q125-72831562-72832500, MOR248-3
MMRRC Submission 043076-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5517 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 111610658-111611605 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 111610804 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 46 (M46I)
Ref Sequence ENSEMBL: ENSMUSP00000150896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054004] [ENSMUST00000119566] [ENSMUST00000214708] [ENSMUST00000215244]
AlphaFold Q8VGE9
Predicted Effect probably benign
Transcript: ENSMUST00000054004
AA Change: M49I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061674
Gene: ENSMUSG00000044560
AA Change: M49I

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 2.4e-49 PFAM
Pfam:7tm_1 44 290 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119566
AA Change: M46I
Predicted Effect probably benign
Transcript: ENSMUST00000214708
AA Change: M46I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215244
AA Change: M46I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,269,233 (GRCm39) R675K possibly damaging Het
Aire A T 10: 77,875,525 (GRCm39) S282T probably benign Het
Ak9 A G 10: 41,216,887 (GRCm39) E283G probably benign Het
Akap9 T A 5: 4,051,665 (GRCm39) D1477E possibly damaging Het
Ap2a1 T C 7: 44,556,405 (GRCm39) D273G possibly damaging Het
Apob T C 12: 8,040,906 (GRCm39) L664P probably damaging Het
Arhgap35 A T 7: 16,297,414 (GRCm39) F550L probably damaging Het
Armc2 T C 10: 41,839,846 (GRCm39) E373G probably benign Het
Atp8b2 C A 3: 89,853,338 (GRCm39) A726S probably benign Het
C030048H21Rik T A 2: 26,145,899 (GRCm39) Q87L probably damaging Het
Cd244a T A 1: 171,405,542 (GRCm39) probably benign Het
Cdk10 T A 8: 123,957,326 (GRCm39) probably null Het
Cenpe C A 3: 134,929,026 (GRCm39) P310Q probably damaging Het
Chuk T A 19: 44,085,972 (GRCm39) probably null Het
Crebl2 T C 6: 134,828,139 (GRCm39) S104P probably benign Het
Ddo A G 10: 40,523,726 (GRCm39) K239E probably benign Het
Defb5 A G 8: 19,300,868 (GRCm39) probably null Het
Dhx35 T A 2: 158,676,832 (GRCm39) M422K probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Gatm G A 2: 122,426,024 (GRCm39) T409I probably damaging Het
Gdpd1 A T 11: 86,950,332 (GRCm39) D80E probably damaging Het
Gspt1 C A 16: 11,071,843 (GRCm39) G7C unknown Het
Hells G A 19: 38,943,244 (GRCm39) S516N probably benign Het
Ints1 A G 5: 139,738,542 (GRCm39) S2069P possibly damaging Het
Kank4 G A 4: 98,663,118 (GRCm39) T690M probably damaging Het
Kcnq4 T C 4: 120,573,006 (GRCm39) N265S possibly damaging Het
Kif5b C A 18: 6,220,954 (GRCm39) A385S probably benign Het
Map2 T C 1: 66,454,415 (GRCm39) S1102P probably benign Het
Mcm7 A G 5: 138,163,133 (GRCm39) S340P possibly damaging Het
Mcrs1 C T 15: 99,144,876 (GRCm39) R246H possibly damaging Het
Myo16 T A 8: 10,610,226 (GRCm39) M1189K probably benign Het
Or4d2 A T 11: 87,783,892 (GRCm39) I286N probably damaging Het
Or7g29 G A 9: 19,287,063 (GRCm39) T38I probably damaging Het
Otog A G 7: 45,923,995 (GRCm39) N1118S probably damaging Het
Pakap T C 4: 57,855,987 (GRCm39) Y439H probably damaging Het
Pcdhb7 G T 18: 37,474,846 (GRCm39) probably benign Het
Picalm C T 7: 89,819,806 (GRCm39) T189I possibly damaging Het
Ptx4 T A 17: 25,343,760 (GRCm39) S337T possibly damaging Het
Rad51ap2 C T 12: 11,508,313 (GRCm39) S745L probably benign Het
Rspry1 G A 8: 95,363,388 (GRCm39) probably null Het
Scn5a T G 9: 119,324,779 (GRCm39) I1350L probably damaging Het
Sgk2 T C 2: 162,839,755 (GRCm39) L121P probably damaging Het
Slc17a1 A T 13: 24,056,575 (GRCm39) probably benign Het
Slc6a12 A G 6: 121,331,298 (GRCm39) N183S probably benign Het
Smg9 C A 7: 24,114,338 (GRCm39) probably benign Het
Spred1 G A 2: 117,008,195 (GRCm39) S367N probably damaging Het
Srpra T C 9: 35,122,646 (GRCm39) V21A probably benign Het
Taar2 A T 10: 23,816,627 (GRCm39) I56F possibly damaging Het
Taf1a T G 1: 183,177,323 (GRCm39) L67R probably damaging Het
Tbc1d10b C A 7: 126,797,779 (GRCm39) R787S possibly damaging Het
Topbp1 T A 9: 103,213,313 (GRCm39) N1044K probably benign Het
Usp24 A G 4: 106,232,871 (GRCm39) T886A probably benign Het
Vmn2r26 A G 6: 124,027,676 (GRCm39) D472G probably damaging Het
Zyg11a T C 4: 108,061,943 (GRCm39) N286S possibly damaging Het
Other mutations in Or4k52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Or4k52 APN 2 111,611,246 (GRCm39) missense possibly damaging 0.80
IGL01604:Or4k52 APN 2 111,610,935 (GRCm39) missense possibly damaging 0.60
IGL02959:Or4k52 APN 2 111,610,955 (GRCm39) missense probably damaging 1.00
IGL02975:Or4k52 APN 2 111,611,266 (GRCm39) nonsense probably null
IGL03357:Or4k52 APN 2 111,610,871 (GRCm39) missense probably benign 0.01
R0245:Or4k52 UTSW 2 111,610,680 (GRCm39) missense probably damaging 1.00
R1522:Or4k52 UTSW 2 111,610,693 (GRCm39) splice site probably null
R2126:Or4k52 UTSW 2 111,610,841 (GRCm39) missense probably damaging 0.99
R2432:Or4k52 UTSW 2 111,611,016 (GRCm39) missense probably benign 0.01
R4780:Or4k52 UTSW 2 111,611,190 (GRCm39) missense probably damaging 1.00
R5260:Or4k52 UTSW 2 111,611,526 (GRCm39) missense probably damaging 1.00
R6273:Or4k52 UTSW 2 111,611,567 (GRCm39) missense probably benign 0.00
R7315:Or4k52 UTSW 2 111,611,004 (GRCm39) missense probably damaging 0.96
R7740:Or4k52 UTSW 2 111,610,793 (GRCm39) missense possibly damaging 0.94
R8742:Or4k52 UTSW 2 111,610,910 (GRCm39) missense probably benign 0.03
R8891:Or4k52 UTSW 2 111,611,186 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAAGGTTGTTTCTGAAGACAC -3'
(R):5'- GCCACATAACGGTCATATGCC -3'

Sequencing Primer
(F):5'- AGGTTGTTTCTGAAGACACATGAG -3'
(R):5'- TCTCCTGCAGCAATGCAATGAG -3'
Posted On 2016-10-05