Incidental Mutation 'R5517:Atp8b2'
ID 431329
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene Name ATPase, class I, type 8B, member 2
Synonyms Id
MMRRC Submission 043076-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R5517 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 89846795-89870645 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89853338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 726 (A726S)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]
AlphaFold P98199
Predicted Effect probably benign
Transcript: ENSMUST00000069805
AA Change: A745S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: A745S

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107396
AA Change: A750S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: A750S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect probably benign
Transcript: ENSMUST00000166502
SMART Domains Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
SCOP:d1eula_ 2 95 5e-7 SMART
low complexity region 100 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect unknown
Transcript: ENSMUST00000171941
AA Change: A60S
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671
AA Change: A60S

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168276
AA Change: A726S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: A726S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,269,233 (GRCm39) R675K possibly damaging Het
Aire A T 10: 77,875,525 (GRCm39) S282T probably benign Het
Ak9 A G 10: 41,216,887 (GRCm39) E283G probably benign Het
Akap9 T A 5: 4,051,665 (GRCm39) D1477E possibly damaging Het
Ap2a1 T C 7: 44,556,405 (GRCm39) D273G possibly damaging Het
Apob T C 12: 8,040,906 (GRCm39) L664P probably damaging Het
Arhgap35 A T 7: 16,297,414 (GRCm39) F550L probably damaging Het
Armc2 T C 10: 41,839,846 (GRCm39) E373G probably benign Het
C030048H21Rik T A 2: 26,145,899 (GRCm39) Q87L probably damaging Het
Cd244a T A 1: 171,405,542 (GRCm39) probably benign Het
Cdk10 T A 8: 123,957,326 (GRCm39) probably null Het
Cenpe C A 3: 134,929,026 (GRCm39) P310Q probably damaging Het
Chuk T A 19: 44,085,972 (GRCm39) probably null Het
Crebl2 T C 6: 134,828,139 (GRCm39) S104P probably benign Het
Ddo A G 10: 40,523,726 (GRCm39) K239E probably benign Het
Defb5 A G 8: 19,300,868 (GRCm39) probably null Het
Dhx35 T A 2: 158,676,832 (GRCm39) M422K probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Gatm G A 2: 122,426,024 (GRCm39) T409I probably damaging Het
Gdpd1 A T 11: 86,950,332 (GRCm39) D80E probably damaging Het
Gspt1 C A 16: 11,071,843 (GRCm39) G7C unknown Het
Hells G A 19: 38,943,244 (GRCm39) S516N probably benign Het
Ints1 A G 5: 139,738,542 (GRCm39) S2069P possibly damaging Het
Kank4 G A 4: 98,663,118 (GRCm39) T690M probably damaging Het
Kcnq4 T C 4: 120,573,006 (GRCm39) N265S possibly damaging Het
Kif5b C A 18: 6,220,954 (GRCm39) A385S probably benign Het
Map2 T C 1: 66,454,415 (GRCm39) S1102P probably benign Het
Mcm7 A G 5: 138,163,133 (GRCm39) S340P possibly damaging Het
Mcrs1 C T 15: 99,144,876 (GRCm39) R246H possibly damaging Het
Myo16 T A 8: 10,610,226 (GRCm39) M1189K probably benign Het
Or4d2 A T 11: 87,783,892 (GRCm39) I286N probably damaging Het
Or4k52 G T 2: 111,610,804 (GRCm39) M46I probably benign Het
Or7g29 G A 9: 19,287,063 (GRCm39) T38I probably damaging Het
Otog A G 7: 45,923,995 (GRCm39) N1118S probably damaging Het
Pakap T C 4: 57,855,987 (GRCm39) Y439H probably damaging Het
Pcdhb7 G T 18: 37,474,846 (GRCm39) probably benign Het
Picalm C T 7: 89,819,806 (GRCm39) T189I possibly damaging Het
Ptx4 T A 17: 25,343,760 (GRCm39) S337T possibly damaging Het
Rad51ap2 C T 12: 11,508,313 (GRCm39) S745L probably benign Het
Rspry1 G A 8: 95,363,388 (GRCm39) probably null Het
Scn5a T G 9: 119,324,779 (GRCm39) I1350L probably damaging Het
Sgk2 T C 2: 162,839,755 (GRCm39) L121P probably damaging Het
Slc17a1 A T 13: 24,056,575 (GRCm39) probably benign Het
Slc6a12 A G 6: 121,331,298 (GRCm39) N183S probably benign Het
Smg9 C A 7: 24,114,338 (GRCm39) probably benign Het
Spred1 G A 2: 117,008,195 (GRCm39) S367N probably damaging Het
Srpra T C 9: 35,122,646 (GRCm39) V21A probably benign Het
Taar2 A T 10: 23,816,627 (GRCm39) I56F possibly damaging Het
Taf1a T G 1: 183,177,323 (GRCm39) L67R probably damaging Het
Tbc1d10b C A 7: 126,797,779 (GRCm39) R787S possibly damaging Het
Topbp1 T A 9: 103,213,313 (GRCm39) N1044K probably benign Het
Usp24 A G 4: 106,232,871 (GRCm39) T886A probably benign Het
Vmn2r26 A G 6: 124,027,676 (GRCm39) D472G probably damaging Het
Zyg11a T C 4: 108,061,943 (GRCm39) N286S possibly damaging Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89,857,160 (GRCm39) missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89,861,546 (GRCm39) missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89,861,896 (GRCm39) splice site probably null
IGL03057:Atp8b2 APN 3 89,851,493 (GRCm39) missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89,865,124 (GRCm39) missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89,855,828 (GRCm39) missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89,866,368 (GRCm39) splice site probably benign
R0784:Atp8b2 UTSW 3 89,864,380 (GRCm39) missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89,855,111 (GRCm39) missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89,851,477 (GRCm39) missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89,857,155 (GRCm39) missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89,849,091 (GRCm39) missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89,860,001 (GRCm39) missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89,853,583 (GRCm39) missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89,849,065 (GRCm39) missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89,865,600 (GRCm39) missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89,852,459 (GRCm39) missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89,852,459 (GRCm39) missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3741:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3742:Atp8b2 UTSW 3 89,853,338 (GRCm39) missense probably benign
R3896:Atp8b2 UTSW 3 89,864,626 (GRCm39) missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89,861,755 (GRCm39) missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89,849,091 (GRCm39) missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89,864,374 (GRCm39) missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89,853,287 (GRCm39) missense probably benign
R4905:Atp8b2 UTSW 3 89,856,315 (GRCm39) missense probably benign
R4925:Atp8b2 UTSW 3 89,853,930 (GRCm39) critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89,860,227 (GRCm39) unclassified probably benign
R5433:Atp8b2 UTSW 3 89,860,216 (GRCm39) unclassified probably benign
R5458:Atp8b2 UTSW 3 89,853,329 (GRCm39) missense probably benign 0.00
R5663:Atp8b2 UTSW 3 89,849,101 (GRCm39) missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89,853,528 (GRCm39) missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89,855,480 (GRCm39) missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89,861,878 (GRCm39) missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89,850,979 (GRCm39) missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89,852,831 (GRCm39) missense
R7552:Atp8b2 UTSW 3 89,854,071 (GRCm39) missense probably damaging 1.00
R8061:Atp8b2 UTSW 3 89,853,527 (GRCm39) unclassified probably benign
R8491:Atp8b2 UTSW 3 89,865,676 (GRCm39) missense probably damaging 1.00
R8827:Atp8b2 UTSW 3 89,853,307 (GRCm39) missense
R8913:Atp8b2 UTSW 3 89,852,830 (GRCm39) missense
R8996:Atp8b2 UTSW 3 89,850,696 (GRCm39) missense probably damaging 1.00
R9154:Atp8b2 UTSW 3 89,865,927 (GRCm39) missense possibly damaging 0.52
R9341:Atp8b2 UTSW 3 89,855,811 (GRCm39) missense possibly damaging 0.95
R9343:Atp8b2 UTSW 3 89,855,811 (GRCm39) missense possibly damaging 0.95
R9439:Atp8b2 UTSW 3 89,851,492 (GRCm39) missense
R9466:Atp8b2 UTSW 3 89,851,484 (GRCm39) missense probably benign 0.33
R9590:Atp8b2 UTSW 3 89,865,693 (GRCm39) nonsense probably null
R9651:Atp8b2 UTSW 3 89,865,603 (GRCm39) missense probably damaging 1.00
R9739:Atp8b2 UTSW 3 89,853,403 (GRCm39) missense probably benign
R9778:Atp8b2 UTSW 3 89,861,865 (GRCm39) missense possibly damaging 0.95
Z1088:Atp8b2 UTSW 3 89,861,875 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCAACAAGGTCTGAGC -3'
(R):5'- ATGCTGACTGACGACATGACAG -3'

Sequencing Primer
(F):5'- AACAAGGTCTGAGCACTGTCCTG -3'
(R):5'- GTTTGTAGTCACAGGCCACACTG -3'
Posted On 2016-10-05