Incidental Mutation 'R5517:Akap2'
ID431332
Institutional Source Beutler Lab
Gene Symbol Akap2
Ensembl Gene ENSMUSG00000038729
Gene NameA kinase (PRKA) anchor protein 2
SynonymsAKAP-KL, B230340M18Rik
MMRRC Submission 043076-MU
Accession Numbers

Genbank: NM_001035533; MGI: 1306795

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location57717657-57896984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57855987 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 439 (Y439H)
Ref Sequence ENSEMBL: ENSMUSP00000103224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043456] [ENSMUST00000098064] [ENSMUST00000098066] [ENSMUST00000102902] [ENSMUST00000102903] [ENSMUST00000107598] [ENSMUST00000107600] [ENSMUST00000124581] [ENSMUST00000126465] [ENSMUST00000132497]
Predicted Effect probably damaging
Transcript: ENSMUST00000043456
AA Change: Y439H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048678
Gene: ENSMUSG00000038729
AA Change: Y439H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 568 885 2.5e-17 PFAM
Pfam:RII_binding_1 585 602 1.6e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098064
AA Change: Y439H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095672
Gene: ENSMUSG00000038729
AA Change: Y439H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098065
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102902
AA Change: Y439H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099966
Gene: ENSMUSG00000038729
AA Change: Y439H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102903
AA Change: Y439H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099967
Gene: ENSMUSG00000038729
AA Change: Y439H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107598
AA Change: Y439H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103224
Gene: ENSMUSG00000038729
AA Change: Y439H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107600
AA Change: Y480H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103226
Gene: ENSMUSG00000038729
AA Change: Y480H

DomainStartEndE-ValueType
low complexity region 193 204 N/A INTRINSIC
low complexity region 254 268 N/A INTRINSIC
coiled coil region 297 355 N/A INTRINSIC
Pfam:AKAP2_C 636 913 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124581
SMART Domains Protein: ENSMUSP00000119742
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132497
Predicted Effect unknown
Transcript: ENSMUST00000150412
AA Change: Y682H
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945
AA Change: Y682H

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the regulatory subunit of protein kinase A and is found associated with the actin cytoskeleton. The encoded protein mediates signals carried by cAMP and may be involved in creating polarity in certain signaling processes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Akap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
A9681:Akap2 UTSW 4 57855358 missense probably damaging 1.00
IGL02835:Akap2 UTSW 4 57883044 missense probably damaging 1.00
R0284:Akap2 UTSW 4 57855207 missense probably damaging 1.00
R0356:Akap2 UTSW 4 57855628 missense possibly damaging 0.48
R0594:Akap2 UTSW 4 57856752 missense probably benign 0.00
R0614:Akap2 UTSW 4 57856720 missense probably benign 0.41
R0617:Akap2 UTSW 4 57829434 intron probably benign
R1228:Akap2 UTSW 4 57856909 missense probably damaging 1.00
R2081:Akap2 UTSW 4 57855927 missense possibly damaging 0.49
R2128:Akap2 UTSW 4 57854890 missense probably benign 0.40
R4667:Akap2 UTSW 4 57855655 missense possibly damaging 0.80
R4804:Akap2 UTSW 4 57854688 missense probably benign 0.05
R4989:Akap2 UTSW 4 57856552 missense probably benign
R5135:Akap2 UTSW 4 57855912 missense probably benign 0.00
R5292:Akap2 UTSW 4 57855356 missense probably damaging 0.98
R5420:Akap2 UTSW 4 57856062 missense probably benign 0.08
R5420:Akap2 UTSW 4 57856434 missense probably damaging 1.00
R5648:Akap2 UTSW 4 57854848 missense probably damaging 1.00
R5886:Akap2 UTSW 4 57856295 missense probably damaging 1.00
R5993:Akap2 UTSW 4 57855273 missense possibly damaging 0.86
R6133:Akap2 UTSW 4 57855516 nonsense probably null
R6189:Akap2 UTSW 4 57855928 missense probably benign 0.00
R6221:Akap2 UTSW 4 57855618 nonsense probably null
R6532:Akap2 UTSW 4 57855174 missense probably benign 0.00
R6760:Akap2 UTSW 4 57856026 missense probably damaging 1.00
R6792:Akap2 UTSW 4 57855880 missense possibly damaging 0.90
R7128:Akap2 UTSW 4 57855816 missense probably benign 0.03
R7269:Akap2 UTSW 4 57855217 missense probably damaging 1.00
R7837:Akap2 UTSW 4 57855262 missense probably damaging 1.00
R7920:Akap2 UTSW 4 57855262 missense probably damaging 1.00
Z1177:Akap2 UTSW 4 57856348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCCATTCGGACAAGC -3'
(R):5'- TCATTGGACAGAGTCTCCAGG -3'

Sequencing Primer
(F):5'- GCCACCGACCATCTTGAG -3'
(R):5'- AGTCTCCAGGACAGTGGTATC -3'
Posted On2016-10-05