Mutagenetix > Incidental Mutation

Incidental Mutation 'R5517:Kank4'

431333

Institutional Source

Beutler Lab

Gene Symbol

Kank4

Ensembl Gene

ENSMUSG00000035407

Gene Name

KN motif and ankyrin repeat domains 4

Synonyms

Ankrd38

MMRRC Submission

043076-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R5517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98754898-98817537 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 98774881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 690 (T690M)

Ref Sequence

ENSEMBL: ENSMUSP00000099851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102790]

AlphaFold

Q6P9J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000102790
AA Change: T690M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: T690M

Domain	Start	End	E-Value	Type
Pfam:KN_motif	24	62	5.6e-26	PFAM
low complexity region	280	295	N/A	INTRINSIC
low complexity region	300	320	N/A	INTRINSIC
coiled coil region	345	409	N/A	INTRINSIC
low complexity region	505	521	N/A	INTRINSIC
low complexity region	600	624	N/A	INTRINSIC
low complexity region	625	655	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
ANK	838	868	7.42e-4	SMART
ANK	877	905	2.08e3	SMART
ANK	910	939	1.11e-2	SMART
ANK	943	973	8.99e-3	SMART
ANK	977	1006	2.43e3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137270

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.5%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	C	T	17: 35,958,341	R675K	possibly damaging	Het
Aire	A	T	10: 78,039,691	S282T	probably benign	Het
Ak9	A	G	10: 41,340,891	E283G	probably benign	Het
Akap2	T	C	4: 57,855,987	Y439H	probably damaging	Het
Akap9	T	A	5: 4,001,665	D1477E	possibly damaging	Het
Ap2a1	T	C	7: 44,906,981	D273G	possibly damaging	Het
Apob	T	C	12: 7,990,906	L664P	probably damaging	Het
Arhgap35	A	T	7: 16,563,489	F550L	probably damaging	Het
Armc2	T	C	10: 41,963,850	E373G	probably benign	Het
Atp8b2	C	A	3: 89,946,031	A726S	probably benign	Het
C030048H21Rik	T	A	2: 26,255,887	Q87L	probably damaging	Het
Cd244	T	A	1: 171,577,974		probably benign	Het
Cdk10	T	A	8: 123,230,587		probably null	Het
Cenpe	C	A	3: 135,223,265	P310Q	probably damaging	Het
Chuk	T	A	19: 44,097,533		probably null	Het
Crebl2	T	C	6: 134,851,176	S104P	probably benign	Het
Ddo	A	G	10: 40,647,730	K239E	probably benign	Het
Defb5	A	G	8: 19,250,852		probably null	Het
Dhx35	T	A	2: 158,834,912	M422K	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gatm	G	A	2: 122,595,543	T409I	probably damaging	Het
Gdpd1	A	T	11: 87,059,506	D80E	probably damaging	Het
Gspt1	C	A	16: 11,253,979	G7C	unknown	Het
Hells	G	A	19: 38,954,800	S516N	probably benign	Het
Ints1	A	G	5: 139,752,787	S2069P	possibly damaging	Het
Kcnq4	T	C	4: 120,715,809	N265S	possibly damaging	Het
Kif5b	C	A	18: 6,220,954	A385S	probably benign	Het
Map2	T	C	1: 66,415,256	S1102P	probably benign	Het
Mcm7	A	G	5: 138,164,871	S340P	possibly damaging	Het
Mcrs1	C	T	15: 99,246,995	R246H	possibly damaging	Het
Myo16	T	A	8: 10,560,226	M1189K	probably benign	Het
Olfr1302	G	T	2: 111,780,459	M46I	probably benign	Het
Olfr463	A	T	11: 87,893,066	I286N	probably damaging	Het
Olfr847	G	A	9: 19,375,767	T38I	probably damaging	Het
Otog	A	G	7: 46,274,571	N1118S	probably damaging	Het
Pcdhb7	G	T	18: 37,341,793		probably benign	Het
Picalm	C	T	7: 90,170,598	T189I	possibly damaging	Het
Ptx4	T	A	17: 25,124,786	S337T	possibly damaging	Het
Rad51ap2	C	T	12: 11,458,312	S745L	probably benign	Het
Rspry1	G	A	8: 94,636,760		probably null	Het
Scn5a	T	G	9: 119,495,713	I1350L	probably damaging	Het
Sgk2	T	C	2: 162,997,835	L121P	probably damaging	Het
Slc17a1	A	T	13: 23,872,592		probably benign	Het
Slc6a12	A	G	6: 121,354,339	N183S	probably benign	Het
Smg9	C	A	7: 24,414,913		probably benign	Het
Spred1	G	A	2: 117,177,714	S367N	probably damaging	Het
Srpr	T	C	9: 35,211,350	V21A	probably benign	Het
Taar2	A	T	10: 23,940,729	I56F	possibly damaging	Het
Taf1a	T	G	1: 183,395,985	L67R	probably damaging	Het
Tbc1d10b	C	A	7: 127,198,607	R787S	possibly damaging	Het
Topbp1	T	A	9: 103,336,114	N1044K	probably benign	Het
Usp24	A	G	4: 106,375,674	T886A	probably benign	Het
Vmn2r26	A	G	6: 124,050,717	D472G	probably damaging	Het
Zyg11a	T	C	4: 108,204,746	N286S	possibly damaging	Het

Other mutations in Kank4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Kank4	APN	4	98778395	missense	probably damaging	0.99
IGL02634:Kank4	APN	4	98778827	missense	probably benign	0.06
IGL02883:Kank4	APN	4	98773453	missense	possibly damaging	0.87
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0081:Kank4	UTSW	4	98778330	missense	probably benign	0.02
R0219:Kank4	UTSW	4	98778465	missense	probably benign	0.06
R0498:Kank4	UTSW	4	98779636	missense	probably benign
R0609:Kank4	UTSW	4	98777105	missense	probably damaging	0.99
R0855:Kank4	UTSW	4	98771444	missense	probably damaging	1.00
R0865:Kank4	UTSW	4	98774663	splice site	probably benign
R0961:Kank4	UTSW	4	98756519	missense	probably benign	0.02
R1172:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1173:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1175:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1381:Kank4	UTSW	4	98779938	missense	probably damaging	0.98
R1517:Kank4	UTSW	4	98779029	missense	possibly damaging	0.83
R1573:Kank4	UTSW	4	98774836	nonsense	probably null
R1668:Kank4	UTSW	4	98778896	missense	probably damaging	0.98
R2051:Kank4	UTSW	4	98780102	missense	probably damaging	0.99
R2253:Kank4	UTSW	4	98779226	missense	probably damaging	0.99
R2656:Kank4	UTSW	4	98778957	missense	probably damaging	0.99
R3801:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3802:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3804:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3945:Kank4	UTSW	4	98771280	missense	probably damaging	1.00
R4172:Kank4	UTSW	4	98779121	missense	probably damaging	1.00
R4502:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R4503:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R5024:Kank4	UTSW	4	98785661	missense	probably damaging	0.99
R5105:Kank4	UTSW	4	98779159	missense	probably benign	0.01
R5122:Kank4	UTSW	4	98756567	missense	probably damaging	1.00
R5255:Kank4	UTSW	4	98778972	missense	probably benign
R5484:Kank4	UTSW	4	98774785	missense	probably benign
R5550:Kank4	UTSW	4	98771441	missense	probably benign	0.27
R5667:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5671:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5865:Kank4	UTSW	4	98771393	missense	possibly damaging	0.50
R6176:Kank4	UTSW	4	98765554	missense	probably damaging	1.00
R6778:Kank4	UTSW	4	98761505	missense	probably benign	0.01
R7084:Kank4	UTSW	4	98771345	missense	probably damaging	1.00
R7085:Kank4	UTSW	4	98779946	missense	probably benign
R7112:Kank4	UTSW	4	98761521	missense	probably damaging	0.99
R8307:Kank4	UTSW	4	98778678	nonsense	probably null
R8431:Kank4	UTSW	4	98779272	missense	probably benign	0.33
R8447:Kank4	UTSW	4	98778492	missense	probably damaging	0.99
R8483:Kank4	UTSW	4	98771378	missense	probably damaging	1.00
R8505:Kank4	UTSW	4	98785676	start gained	probably benign
R8805:Kank4	UTSW	4	98780036	missense	possibly damaging	0.93
R8823:Kank4	UTSW	4	98780003	missense	probably damaging	0.99
R8888:Kank4	UTSW	4	98765510	missense	possibly damaging	0.88
R8895:Kank4	UTSW	4	98765510	missense	possibly damaging	0.88
R9155:Kank4	UTSW	4	98778326	missense	probably benign
R9189:Kank4	UTSW	4	98780052	nonsense	probably null
R9291:Kank4	UTSW	4	98778451	missense	probably benign	0.00
R9509:Kank4	UTSW	4	98774867	missense	possibly damaging	0.86
R9618:Kank4	UTSW	4	98765495	missense	possibly damaging	0.76
X0027:Kank4	UTSW	4	98779923	missense	probably benign	0.00
Z1176:Kank4	UTSW	4	98778294	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGATGAGACACTTCCTCCC -3'
(R):5'- ACCAGATGTAATCTTGGCTGG -3'

Sequencing Primer
(F):5'- CCACGATCACTTGTGTGGC -3'
(R):5'- CCAGATGTAATCTTGGCTGGAATAAG -3'

Posted On

2016-10-05