Incidental Mutation 'R5517:Ap2a1'
ID431346
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Nameadaptor-related protein complex 2, alpha 1 subunit
SynonymsAdtaa
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5517 (G1)
Quality Score140
Status Validated
Chromosome7
Chromosomal Location44900373-44929496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44906981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 273 (D273G)
Ref Sequence ENSEMBL: ENSMUSP00000127497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085399
AA Change: D273G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279
AA Change: D273G

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107857
AA Change: D273G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279
AA Change: D273G

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166972
AA Change: D273G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279
AA Change: D273G

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167930
AA Change: D273G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279
AA Change: D273G

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207426
Predicted Effect probably benign
Transcript: ENSMUST00000207814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Meta Mutation Damage Score 0.6716 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44905768 missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44916289 missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44905696 missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44906426 missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44903511 missense probably benign
IGL03172:Ap2a1 APN 7 44904055 missense probably benign 0.00
disaffected UTSW 7 44916164 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44904708 missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44904169 unclassified probably benign
R1566:Ap2a1 UTSW 7 44903480 missense probably benign 0.02
R1682:Ap2a1 UTSW 7 44915938 missense probably benign 0.14
R1745:Ap2a1 UTSW 7 44906945 missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44904152 missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44904419 missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44902919 unclassified probably benign
R4776:Ap2a1 UTSW 7 44901546 unclassified probably benign
R4909:Ap2a1 UTSW 7 44906381 missense probably damaging 1.00
R5040:Ap2a1 UTSW 7 44905804 missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44902779 missense probably benign 0.00
R5310:Ap2a1 UTSW 7 44906065 splice site probably null
R5635:Ap2a1 UTSW 7 44923901 intron probably benign
R6002:Ap2a1 UTSW 7 44904395 unclassified probably null
R6083:Ap2a1 UTSW 7 44907751 missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44916170 missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44903829 missense probably benign
R6491:Ap2a1 UTSW 7 44916164 missense probably damaging 1.00
R7058:Ap2a1 UTSW 7 44900791 missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44923804 intron probably null
R7490:Ap2a1 UTSW 7 44902789 missense probably benign 0.03
R7765:Ap2a1 UTSW 7 44909736 missense probably damaging 1.00
R7831:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
R7914:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCCCAGGTGTTAGATG -3'
(R):5'- GGAGCCCAGACCTAGAAATTG -3'

Sequencing Primer
(F):5'- AGGTGTTAGATGCCAGCCTC -3'
(R):5'- GCCCAGACCTAGAAATTGCTGATC -3'
Posted On2016-10-05