Incidental Mutation 'R0469:Ikbkb'
ID43135
Institutional Source Beutler Lab
Gene Symbol Ikbkb
Ensembl Gene ENSMUSG00000031537
Gene Nameinhibitor of kappaB kinase beta
SynonymsIKK2, IKK[b], IKKbeta, IKK-beta, IKK-2
MMRRC Submission 038669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0469 (G1)
Quality Score151
Status Not validated
Chromosome8
Chromosomal Location22659212-22706589 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22671635 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 412 (C412*)
Ref Sequence ENSEMBL: ENSMUSP00000138378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033939] [ENSMUST00000063401] [ENSMUST00000125314] [ENSMUST00000135326]
Predicted Effect probably null
Transcript: ENSMUST00000033939
AA Change: C412*
SMART Domains Protein: ENSMUSP00000033939
Gene: ENSMUSG00000031537
AA Change: C412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 1.2e-38 PFAM
Pfam:Pkinase 15 296 1.2e-54 PFAM
Pfam:Kdo 31 176 1.3e-7 PFAM
IKKbetaNEMObind 705 742 4.71e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063401
AA Change: C412*
SMART Domains Protein: ENSMUSP00000064235
Gene: ENSMUSG00000031537
AA Change: C412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 7.3e-39 PFAM
Pfam:Pkinase 15 296 6.9e-56 PFAM
Pfam:Kdo 44 177 3e-8 PFAM
IKKbetaNEMObind 705 737 1.83e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125314
AA Change: C412*
SMART Domains Protein: ENSMUSP00000138156
Gene: ENSMUSG00000031537
AA Change: C412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126496
Predicted Effect probably null
Transcript: ENSMUST00000135326
AA Change: C412*
SMART Domains Protein: ENSMUSP00000138378
Gene: ENSMUSG00000031537
AA Change: C412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150259
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
B3gntl1 A T 11: 121,673,025 V3D probably benign Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Golgb1 A G 16: 36,931,635 I3144V probably benign Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr338 A T 2: 36,377,462 I229F probably benign Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rbmx C T X: 57,391,566 probably null Het
Rbp3 A G 14: 33,962,419 K1135R possibly damaging Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tm9sf1 A T 14: 55,641,429 F169I possibly damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,423,667 probably null Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Upb1 T C 10: 75,415,083 probably null Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Ikbkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ikbkb APN 8 22706111 missense probably damaging 0.99
IGL00899:Ikbkb APN 8 22660447 missense possibly damaging 0.84
IGL02271:Ikbkb APN 8 22665903 missense probably benign 0.00
IGL02569:Ikbkb APN 8 22693883 missense probably damaging 1.00
IGL02610:Ikbkb APN 8 22675072 critical splice acceptor site probably null
IGL03085:Ikbkb APN 8 22682786 missense probably benign 0.03
Baby UTSW 8 22675036 missense probably damaging 1.00
Impaired UTSW 8 22666020 missense probably damaging 1.00
Kiki UTSW 8 22671642 missense possibly damaging 0.95
R0110:Ikbkb UTSW 8 22671635 nonsense probably null
R0366:Ikbkb UTSW 8 22695260 splice site probably benign
R0510:Ikbkb UTSW 8 22671635 nonsense probably null
R1386:Ikbkb UTSW 8 22665617 missense possibly damaging 0.69
R1436:Ikbkb UTSW 8 22673403 missense probably benign 0.24
R1645:Ikbkb UTSW 8 22691066 missense probably damaging 0.98
R1695:Ikbkb UTSW 8 22673480 missense probably benign 0.00
R2118:Ikbkb UTSW 8 22667217 splice site probably benign
R2120:Ikbkb UTSW 8 22667217 splice site probably benign
R2121:Ikbkb UTSW 8 22667217 splice site probably benign
R2124:Ikbkb UTSW 8 22666020 missense probably damaging 1.00
R2124:Ikbkb UTSW 8 22667217 splice site probably benign
R2148:Ikbkb UTSW 8 22682745 missense probably damaging 1.00
R2179:Ikbkb UTSW 8 22681753 critical splice acceptor site probably null
R2897:Ikbkb UTSW 8 22669677 missense possibly damaging 0.71
R3861:Ikbkb UTSW 8 22678836 missense possibly damaging 0.94
R4019:Ikbkb UTSW 8 22671712 missense probably benign 0.03
R4723:Ikbkb UTSW 8 22669607 missense probably benign 0.24
R4962:Ikbkb UTSW 8 22681677 missense probably damaging 1.00
R5715:Ikbkb UTSW 8 22678850 missense probably damaging 1.00
R6738:Ikbkb UTSW 8 22675036 missense probably damaging 1.00
R6875:Ikbkb UTSW 8 22665893 missense probably damaging 0.99
R7054:Ikbkb UTSW 8 22671642 missense possibly damaging 0.95
R7284:Ikbkb UTSW 8 22668960 missense probably benign 0.32
R7383:Ikbkb UTSW 8 22669050 missense probably benign
R7633:Ikbkb UTSW 8 22671741 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACCCTGTGCCTACCTCTAGTGAG -3'
(R):5'- ATGTGTGACATGGTGTCTGCCC -3'

Sequencing Primer
(F):5'- CCTCTAGTGAGAGGCAGTTAACC -3'
(R):5'- TGCTTTAAGACCAAGTAGCCG -3'
Posted On2013-05-23