Incidental Mutation 'R5517:Myo16'
ID431350
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 043076-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10560226 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1189 (M1189K)
Ref Sequence ENSEMBL: ENSMUSP00000049345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
Predicted Effect probably benign
Transcript: ENSMUST00000042103
AA Change: M1189K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: M1189K

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: M1133K
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: M1189K
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7319:Myo16 UTSW 8 10476185 synonymous probably null
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
R7498:Myo16 UTSW 8 10400589 missense unknown
R7539:Myo16 UTSW 8 10361095 critical splice donor site probably null
R7622:Myo16 UTSW 8 10376238 missense unknown
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCAAATTCTTATTCTGGGTTG -3'
(R):5'- CTCCCAGGACTCATCTTGTAGG -3'

Sequencing Primer
(F):5'- CAAATTCTTATTCTGGGTTGAATGTG -3'
(R):5'- CAGGACTCATCTTGTAGGTAAGTAAG -3'
Posted On2016-10-05