Incidental Mutation 'R5517:Cdk10'
ID431354
Institutional Source Beutler Lab
Gene Symbol Cdk10
Ensembl Gene ENSMUSG00000033862
Gene Namecyclin-dependent kinase 10
Synonyms
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123224842-123232250 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 123230587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036880] [ENSMUST00000036880] [ENSMUST00000098327] [ENSMUST00000127664] [ENSMUST00000166768] [ENSMUST00000212193] [ENSMUST00000212361] [ENSMUST00000212818] [ENSMUST00000213005] [ENSMUST00000213005] [ENSMUST00000213005]
Predicted Effect probably null
Transcript: ENSMUST00000036880
SMART Domains Protein: ENSMUSP00000045527
Gene: ENSMUSG00000033862

DomainStartEndE-ValueType
S_TKc 39 323 1.52e-87 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036880
SMART Domains Protein: ENSMUSP00000045527
Gene: ENSMUSG00000033862

DomainStartEndE-ValueType
S_TKc 39 323 1.52e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098327
SMART Domains Protein: ENSMUSP00000095932
Gene: ENSMUSG00000033594

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166768
SMART Domains Protein: ENSMUSP00000130306
Gene: ENSMUSG00000033594

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 209 214 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 309 318 N/A INTRINSIC
low complexity region 340 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212021
Predicted Effect probably benign
Transcript: ENSMUST00000212028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212035
Predicted Effect probably benign
Transcript: ENSMUST00000212193
Predicted Effect probably benign
Transcript: ENSMUST00000212361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212784
Predicted Effect probably benign
Transcript: ENSMUST00000212818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212904
Predicted Effect probably null
Transcript: ENSMUST00000213005
Predicted Effect probably null
Transcript: ENSMUST00000213005
Predicted Effect probably null
Transcript: ENSMUST00000213005
Meta Mutation Damage Score 0.9057 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the CDK (cyclin-dependent kinase) subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. The human ortholog has been shown to play a role in cellular proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 1. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Cdk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cdk10 APN 8 123230324 missense possibly damaging 0.78
IGL01613:Cdk10 APN 8 123228387 missense probably damaging 0.99
IGL01682:Cdk10 APN 8 123227658 critical splice acceptor site probably null
IGL02536:Cdk10 APN 8 123227015 missense possibly damaging 0.64
R0612:Cdk10 UTSW 8 123230680 missense probably benign 0.16
R1159:Cdk10 UTSW 8 123228323 splice site probably benign
R2356:Cdk10 UTSW 8 123229169 missense probably damaging 0.99
R4838:Cdk10 UTSW 8 123230614 missense probably damaging 1.00
R5453:Cdk10 UTSW 8 123226392 missense probably benign 0.42
R5804:Cdk10 UTSW 8 123228840 splice site probably null
R6930:Cdk10 UTSW 8 123230608 missense probably damaging 1.00
R6971:Cdk10 UTSW 8 123227674 missense probably damaging 1.00
R7910:Cdk10 UTSW 8 123226366 missense probably damaging 1.00
R7991:Cdk10 UTSW 8 123226366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCAGCATCCAAGGAG -3'
(R):5'- GTTTCCTCAAGCTGTACTGGC -3'

Sequencing Primer
(F):5'- CATCCAAGGAGGGGGAGCAC -3'
(R):5'- GCAGCTTGGAGAAACCCTG -3'
Posted On2016-10-05