Incidental Mutation 'R5517:Olfr847'
ID431355
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19375767 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 38 (T38I)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect probably damaging
Transcript: ENSMUST00000079620
AA Change: T38I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: T38I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212306
AA Change: T38I
Predicted Effect probably damaging
Transcript: ENSMUST00000216839
AA Change: T38I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4186 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7969:Olfr847 UTSW 9 19375906 splice site probably null
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTGCTTTCTAATACAGCG -3'
(R):5'- ATGAAGCATTGTGTCCATACATCTG -3'

Sequencing Primer
(F):5'- TGAGGCAACCTGTGTAACTG -3'
(R):5'- GCAACATGGAACCTGGAA -3'
Posted On2016-10-05