Incidental Mutation 'R5517:Srpra'
ID 431356
Institutional Source Beutler Lab
Gene Symbol Srpra
Ensembl Gene ENSMUSG00000032042
Gene Name signal recognition particle receptor alpha
Synonyms D11Mgi27, 1300011P19Rik, Srpr
MMRRC Submission 043076-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R5517 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 35122499-35128299 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35122646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 21 (V21A)
Ref Sequence ENSEMBL: ENSMUSP00000034541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000132799] [ENSMUST00000138287] [ENSMUST00000151658] [ENSMUST00000154691] [ENSMUST00000142595] [ENSMUST00000138692] [ENSMUST00000139703]
AlphaFold Q9DBG7
Predicted Effect probably benign
Transcript: ENSMUST00000034541
AA Change: V21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042
AA Change: V21A

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043805
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127996
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216618
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142595
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of the endoplasmic reticulum signal recognition particle receptor that, in conjunction with the signal recognition particle, is involved in the targeting and translocation of signal sequence tagged secretory and membrane proteins across the endoplasmic reticulum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,269,233 (GRCm39) R675K possibly damaging Het
Aire A T 10: 77,875,525 (GRCm39) S282T probably benign Het
Ak9 A G 10: 41,216,887 (GRCm39) E283G probably benign Het
Akap9 T A 5: 4,051,665 (GRCm39) D1477E possibly damaging Het
Ap2a1 T C 7: 44,556,405 (GRCm39) D273G possibly damaging Het
Apob T C 12: 8,040,906 (GRCm39) L664P probably damaging Het
Arhgap35 A T 7: 16,297,414 (GRCm39) F550L probably damaging Het
Armc2 T C 10: 41,839,846 (GRCm39) E373G probably benign Het
Atp8b2 C A 3: 89,853,338 (GRCm39) A726S probably benign Het
C030048H21Rik T A 2: 26,145,899 (GRCm39) Q87L probably damaging Het
Cd244a T A 1: 171,405,542 (GRCm39) probably benign Het
Cdk10 T A 8: 123,957,326 (GRCm39) probably null Het
Cenpe C A 3: 134,929,026 (GRCm39) P310Q probably damaging Het
Chuk T A 19: 44,085,972 (GRCm39) probably null Het
Crebl2 T C 6: 134,828,139 (GRCm39) S104P probably benign Het
Ddo A G 10: 40,523,726 (GRCm39) K239E probably benign Het
Defb5 A G 8: 19,300,868 (GRCm39) probably null Het
Dhx35 T A 2: 158,676,832 (GRCm39) M422K probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Gatm G A 2: 122,426,024 (GRCm39) T409I probably damaging Het
Gdpd1 A T 11: 86,950,332 (GRCm39) D80E probably damaging Het
Gspt1 C A 16: 11,071,843 (GRCm39) G7C unknown Het
Hells G A 19: 38,943,244 (GRCm39) S516N probably benign Het
Ints1 A G 5: 139,738,542 (GRCm39) S2069P possibly damaging Het
Kank4 G A 4: 98,663,118 (GRCm39) T690M probably damaging Het
Kcnq4 T C 4: 120,573,006 (GRCm39) N265S possibly damaging Het
Kif5b C A 18: 6,220,954 (GRCm39) A385S probably benign Het
Map2 T C 1: 66,454,415 (GRCm39) S1102P probably benign Het
Mcm7 A G 5: 138,163,133 (GRCm39) S340P possibly damaging Het
Mcrs1 C T 15: 99,144,876 (GRCm39) R246H possibly damaging Het
Myo16 T A 8: 10,610,226 (GRCm39) M1189K probably benign Het
Or4d2 A T 11: 87,783,892 (GRCm39) I286N probably damaging Het
Or4k52 G T 2: 111,610,804 (GRCm39) M46I probably benign Het
Or7g29 G A 9: 19,287,063 (GRCm39) T38I probably damaging Het
Otog A G 7: 45,923,995 (GRCm39) N1118S probably damaging Het
Pakap T C 4: 57,855,987 (GRCm39) Y439H probably damaging Het
Pcdhb7 G T 18: 37,474,846 (GRCm39) probably benign Het
Picalm C T 7: 89,819,806 (GRCm39) T189I possibly damaging Het
Ptx4 T A 17: 25,343,760 (GRCm39) S337T possibly damaging Het
Rad51ap2 C T 12: 11,508,313 (GRCm39) S745L probably benign Het
Rspry1 G A 8: 95,363,388 (GRCm39) probably null Het
Scn5a T G 9: 119,324,779 (GRCm39) I1350L probably damaging Het
Sgk2 T C 2: 162,839,755 (GRCm39) L121P probably damaging Het
Slc17a1 A T 13: 24,056,575 (GRCm39) probably benign Het
Slc6a12 A G 6: 121,331,298 (GRCm39) N183S probably benign Het
Smg9 C A 7: 24,114,338 (GRCm39) probably benign Het
Spred1 G A 2: 117,008,195 (GRCm39) S367N probably damaging Het
Taar2 A T 10: 23,816,627 (GRCm39) I56F possibly damaging Het
Taf1a T G 1: 183,177,323 (GRCm39) L67R probably damaging Het
Tbc1d10b C A 7: 126,797,779 (GRCm39) R787S possibly damaging Het
Topbp1 T A 9: 103,213,313 (GRCm39) N1044K probably benign Het
Usp24 A G 4: 106,232,871 (GRCm39) T886A probably benign Het
Vmn2r26 A G 6: 124,027,676 (GRCm39) D472G probably damaging Het
Zyg11a T C 4: 108,061,943 (GRCm39) N286S possibly damaging Het
Other mutations in Srpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Srpra APN 9 35,124,734 (GRCm39) missense probably damaging 1.00
IGL01806:Srpra APN 9 35,126,201 (GRCm39) missense possibly damaging 0.90
IGL02581:Srpra APN 9 35,126,328 (GRCm39) critical splice donor site probably null
IGL03002:Srpra APN 9 35,126,017 (GRCm39) missense probably damaging 0.98
IGL03132:Srpra APN 9 35,125,574 (GRCm39) splice site probably null
R0294:Srpra UTSW 9 35,126,811 (GRCm39) missense probably damaging 1.00
R0455:Srpra UTSW 9 35,126,277 (GRCm39) missense probably benign 0.01
R0483:Srpra UTSW 9 35,127,291 (GRCm39) missense possibly damaging 0.95
R0531:Srpra UTSW 9 35,124,797 (GRCm39) missense probably benign
R1112:Srpra UTSW 9 35,126,255 (GRCm39) missense probably benign 0.03
R1507:Srpra UTSW 9 35,126,766 (GRCm39) missense probably benign 0.08
R1771:Srpra UTSW 9 35,124,147 (GRCm39) missense possibly damaging 0.69
R1970:Srpra UTSW 9 35,124,834 (GRCm39) splice site probably null
R1971:Srpra UTSW 9 35,124,834 (GRCm39) splice site probably null
R2442:Srpra UTSW 9 35,123,297 (GRCm39) missense possibly damaging 0.90
R4475:Srpra UTSW 9 35,124,155 (GRCm39) missense possibly damaging 0.92
R4575:Srpra UTSW 9 35,125,904 (GRCm39) missense possibly damaging 0.92
R4576:Srpra UTSW 9 35,125,904 (GRCm39) missense possibly damaging 0.92
R4578:Srpra UTSW 9 35,125,904 (GRCm39) missense possibly damaging 0.92
R4793:Srpra UTSW 9 35,124,447 (GRCm39) missense probably benign 0.12
R4930:Srpra UTSW 9 35,126,326 (GRCm39) missense probably benign 0.00
R4942:Srpra UTSW 9 35,126,766 (GRCm39) missense probably benign 0.08
R6208:Srpra UTSW 9 35,127,291 (GRCm39) missense possibly damaging 0.95
R8340:Srpra UTSW 9 35,127,102 (GRCm39) missense probably damaging 1.00
R8414:Srpra UTSW 9 35,126,133 (GRCm39) missense probably benign 0.08
R8861:Srpra UTSW 9 35,127,045 (GRCm39) missense probably benign 0.00
R9481:Srpra UTSW 9 35,126,015 (GRCm39) missense probably damaging 1.00
R9729:Srpra UTSW 9 35,125,569 (GRCm39) missense probably benign 0.03
R9765:Srpra UTSW 9 35,122,670 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGAGTCTACGTCATCTCGCG -3'
(R):5'- CCGACCAGTTTGAGGAGATC -3'

Sequencing Primer
(F):5'- AGGCTCGTAGCGGAAGTGC -3'
(R):5'- CGACCAGTTTGAGGAGATCAGAAC -3'
Posted On 2016-10-05