Incidental Mutation 'R5517:Taar2'
ID431359
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Nametrace amine-associated receptor 2
SynonymsGpr58
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23938572-23941583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23940729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 56 (I56F)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079134
AA Change: I56F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: I56F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Meta Mutation Damage Score 0.6461 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23941368 missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23940675 missense probably benign 0.00
IGL01346:Taar2 APN 10 23941099 missense probably damaging 1.00
IGL01433:Taar2 APN 10 23940759 missense probably benign 0.02
IGL01782:Taar2 APN 10 23941144 missense probably damaging 1.00
IGL03106:Taar2 APN 10 23941297 missense probably damaging 0.99
IGL03372:Taar2 APN 10 23941171 missense probably benign 0.03
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0090:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0103:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0157:Taar2 UTSW 10 23941491 missense probably damaging 1.00
R0189:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0190:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0226:Taar2 UTSW 10 23941063 missense probably damaging 1.00
R0226:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0265:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0267:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0349:Taar2 UTSW 10 23941429 missense possibly damaging 0.79
R0349:Taar2 UTSW 10 23941509 missense probably benign 0.01
R0426:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0556:Taar2 UTSW 10 23940895 missense probably damaging 1.00
R0698:Taar2 UTSW 10 23941495 missense probably benign 0.00
R1191:Taar2 UTSW 10 23941029 missense probably damaging 1.00
R2919:Taar2 UTSW 10 23941556 missense probably benign 0.00
R4615:Taar2 UTSW 10 23941365 missense probably benign 0.43
R4658:Taar2 UTSW 10 23941503 missense probably benign 0.04
R4766:Taar2 UTSW 10 23940771 missense probably damaging 0.98
R4872:Taar2 UTSW 10 23940693 missense probably benign 0.02
R5205:Taar2 UTSW 10 23940976 missense probably benign 0.42
R5271:Taar2 UTSW 10 23941032 missense probably damaging 0.97
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6325:Taar2 UTSW 10 23940717 missense probably benign 0.05
R6398:Taar2 UTSW 10 23941279 missense probably benign 0.00
R6762:Taar2 UTSW 10 23941402 missense probably damaging 0.98
R7121:Taar2 UTSW 10 23940827 missense probably damaging 1.00
R7209:Taar2 UTSW 10 23940699 missense possibly damaging 0.57
R7709:Taar2 UTSW 10 23940723 missense probably benign 0.00
R8045:Taar2 UTSW 10 23941488 missense probably damaging 1.00
Z1176:Taar2 UTSW 10 23941186 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCTCTGATAAGTCCCCTGTG -3'
(R):5'- GGCATAAAATCTATCGACGGCC -3'

Sequencing Primer
(F):5'- TGGATCTTGCCCAGAGAA -3'
(R):5'- TGGAAAATGGACGTTATGCTAAGC -3'
Posted On2016-10-05