Incidental Mutation 'R5517:Aire'
ID431363
Institutional Source Beutler Lab
Gene Symbol Aire
Ensembl Gene ENSMUSG00000000731
Gene Nameautoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
Synonyms
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78030022-78043610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78039691 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 282 (S282T)
Ref Sequence ENSEMBL: ENSMUSP00000121477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000138785] [ENSMUST00000140636] [ENSMUST00000143735] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000154374] [ENSMUST00000155021] [ENSMUST00000156417]
Predicted Effect probably benign
Transcript: ENSMUST00000019257
AA Change: S286T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 8.9e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
low complexity region 398 419 N/A INTRINSIC
PHD 432 475 7.82e-7 SMART
RING 433 474 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105395
AA Change: S286T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105396
AA Change: S286T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
PHD 373 416 7.82e-7 SMART
RING 374 415 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128241
AA Change: S286T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 5 104 3.3e-27 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
low complexity region 399 420 N/A INTRINSIC
PHD 433 476 7.82e-7 SMART
RING 434 475 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130972
AA Change: S282T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: S282T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
low complexity region 394 415 N/A INTRINSIC
PHD 428 471 7.82e-7 SMART
RING 429 470 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131028
SMART Domains Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 5 57 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135316
Predicted Effect probably benign
Transcript: ENSMUST00000138785
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140636
AA Change: S282T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731
AA Change: S282T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143548
Predicted Effect probably benign
Transcript: ENSMUST00000143735
AA Change: S286T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.1e-34 PFAM
SAND 198 264 2.61e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145975
AA Change: S282T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: S282T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
RING 297 338 3.63e0 SMART
low complexity region 395 416 N/A INTRINSIC
PHD 429 472 7.82e-7 SMART
RING 430 471 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148469
AA Change: S282T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731
AA Change: S282T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154374
AA Change: S286T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 7.4e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
PHD 374 417 7.82e-7 SMART
RING 375 416 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155021
AA Change: S282T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: S282T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
PHD 369 412 7.82e-7 SMART
RING 370 411 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156417
AA Change: S286T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731
AA Change: S286T

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Aire
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Aire APN 10 78036723 nonsense probably null
IGL01969:Aire APN 10 78042982 missense probably damaging 1.00
E0370:Aire UTSW 10 78042063 missense probably damaging 1.00
IGL03055:Aire UTSW 10 78043069 missense probably damaging 1.00
R0326:Aire UTSW 10 78042599 missense probably damaging 1.00
R0675:Aire UTSW 10 78034493 splice site probably benign
R1748:Aire UTSW 10 78043480 missense probably damaging 0.99
R1754:Aire UTSW 10 78030290 missense probably damaging 1.00
R2014:Aire UTSW 10 78042958 missense probably damaging 1.00
R2015:Aire UTSW 10 78042958 missense probably damaging 1.00
R3800:Aire UTSW 10 78042055 unclassified probably null
R5424:Aire UTSW 10 78036719 missense probably damaging 1.00
R5983:Aire UTSW 10 78043069 missense probably damaging 1.00
R6135:Aire UTSW 10 78042967 missense probably damaging 1.00
R6856:Aire UTSW 10 78030255 missense probably damaging 1.00
R7405:Aire UTSW 10 78034613 missense probably benign 0.01
R7484:Aire UTSW 10 78042570 missense probably damaging 1.00
R7606:Aire UTSW 10 78037933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATCTCCTAATATGCATCCTTG -3'
(R):5'- TCCAGCATGTCCATTTAGGGG -3'

Sequencing Primer
(F):5'- TGCATCCTTGAAAACTTCCAAG -3'
(R):5'- GAGCTGGGCCTTCCTTCCATAG -3'
Posted On2016-10-05