Incidental Mutation 'R5517:Mcrs1'
ID431370
Institutional Source Beutler Lab
Gene Symbol Mcrs1
Ensembl Gene ENSMUSG00000037570
Gene Namemicrospherule protein 1
SynonymsP78, MSP58, ICP22BP, C78274
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99242817-99251961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99246995 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 246 (R246H)
Ref Sequence ENSEMBL: ENSMUSP00000043901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041190] [ENSMUST00000041415] [ENSMUST00000163506] [ENSMUST00000229359] [ENSMUST00000229671] [ENSMUST00000229926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041190
AA Change: R246H

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043901
Gene: ENSMUSG00000037570
AA Change: R246H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 81 113 N/A INTRINSIC
Pfam:MCRS_N 134 331 5.7e-98 PFAM
FHA 362 419 2.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041415
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163506
AA Change: R233H

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131407
Gene: ENSMUSG00000037570
AA Change: R233H

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 68 100 N/A INTRINSIC
Pfam:MCRS_N 121 318 2.4e-97 PFAM
FHA 349 406 2.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229143
Predicted Effect probably benign
Transcript: ENSMUST00000229359
Predicted Effect probably benign
Transcript: ENSMUST00000229399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229656
Predicted Effect probably benign
Transcript: ENSMUST00000229671
Predicted Effect probably benign
Transcript: ENSMUST00000229926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231167
Meta Mutation Damage Score 0.8335 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gdpd1 A T 11: 87,059,506 D80E probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Mcrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Mcrs1 APN 15 99243385 missense probably damaging 0.97
IGL01338:Mcrs1 APN 15 99249501 missense probably damaging 1.00
IGL01975:Mcrs1 APN 15 99243678 critical splice donor site probably null
PIT4651001:Mcrs1 UTSW 15 99246951 missense probably damaging 1.00
R0125:Mcrs1 UTSW 15 99244727 unclassified probably benign
R0520:Mcrs1 UTSW 15 99248455 unclassified probably null
R0744:Mcrs1 UTSW 15 99243449 unclassified probably benign
R0833:Mcrs1 UTSW 15 99243449 unclassified probably benign
R0836:Mcrs1 UTSW 15 99243449 unclassified probably benign
R2099:Mcrs1 UTSW 15 99249946 missense probably benign 0.00
R2133:Mcrs1 UTSW 15 99243375 missense probably damaging 1.00
R4557:Mcrs1 UTSW 15 99243147 missense probably benign 0.01
R5425:Mcrs1 UTSW 15 99243688 missense probably damaging 1.00
R7129:Mcrs1 UTSW 15 99248728 missense probably damaging 1.00
R8012:Mcrs1 UTSW 15 99249885 missense probably damaging 1.00
R8015:Mcrs1 UTSW 15 99248854 nonsense probably null
R8025:Mcrs1 UTSW 15 99246933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGCAGCAGGTTCTGTTG -3'
(R):5'- TGATGGAAACCATGCCTGG -3'

Sequencing Primer
(F):5'- GGGCTGCTGAGAACTCTC -3'
(R):5'- ATGCCTGGCCTCTGGTGAC -3'
Posted On2016-10-05