Incidental Mutation 'R5518:Ptprt'
ID 431382
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 043077-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5518 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 162120143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 108 (D108V)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: D108V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: D108V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: D108V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: D108V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: D108V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: D108V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: D108V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: D108V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.4336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 45,769,873 (GRCm39) E881K probably benign Het
Abcf1 C T 17: 36,269,233 (GRCm39) R675K possibly damaging Het
Abl1 T A 2: 31,680,754 (GRCm39) C349S probably damaging Het
Acot11 C A 4: 106,607,207 (GRCm39) V459L probably benign Het
Ank2 A T 3: 126,753,348 (GRCm39) V311D probably damaging Het
Ankrd11 C G 8: 123,617,733 (GRCm39) E2040Q possibly damaging Het
Ankrd26 T C 6: 118,525,869 (GRCm39) I359V probably benign Het
Armc3 T G 2: 19,302,739 (GRCm39) L684V probably benign Het
Asb10 G A 5: 24,744,643 (GRCm39) P184S probably damaging Het
Atp10b T C 11: 43,042,463 (GRCm39) S8P possibly damaging Het
Blk G T 14: 63,615,956 (GRCm39) S324R possibly damaging Het
C4b G C 17: 34,953,416 (GRCm39) N1022K probably benign Het
Card6 G T 15: 5,134,696 (GRCm39) T169K probably damaging Het
Catsper2 T C 2: 121,236,844 (GRCm39) T268A possibly damaging Het
Cbx3 C T 6: 51,458,726 (GRCm39) P64S probably benign Het
Chchd6 A G 6: 89,544,567 (GRCm39) probably null Het
Cntn1 G A 15: 92,212,534 (GRCm39) E899K probably benign Het
Col6a4 A T 9: 105,949,387 (GRCm39) S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 (GRCm39) N84T probably benign Het
Dcxr A C 11: 120,617,025 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Emsy T C 7: 98,242,818 (GRCm39) Q1107R possibly damaging Het
Erbb2 G T 11: 98,313,596 (GRCm39) C221F probably damaging Het
Exoc3l T C 8: 106,019,795 (GRCm39) N353D probably benign Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
G3bp2 T A 5: 92,216,347 (GRCm39) H63L probably benign Het
Galnt17 A G 5: 130,929,428 (GRCm39) Y460H probably damaging Het
Gm6003 T A 7: 32,865,004 (GRCm39) noncoding transcript Het
Ighv5-12-4 A G 12: 113,726,154 (GRCm39) L23P probably damaging Het
Ins1 T C 19: 52,253,177 (GRCm39) L39P probably damaging Het
Itpr3 T G 17: 27,306,566 (GRCm39) V210G probably damaging Het
Klrb1 T A 6: 128,683,488 (GRCm39) T210S probably benign Het
Krtap24-1 A T 16: 88,408,596 (GRCm39) F177I probably damaging Het
Lrrc37 A T 11: 103,506,079 (GRCm39) I1963K probably benign Het
Mcat A G 15: 83,431,875 (GRCm39) probably null Het
Mknk2 A T 10: 80,504,475 (GRCm39) C229S possibly damaging Het
Mta2 C A 19: 8,925,456 (GRCm39) Q362K probably benign Het
Ndst4 T C 3: 125,232,105 (GRCm39) Y225H probably benign Het
Or4d11 T C 19: 12,013,429 (GRCm39) R226G probably damaging Het
Pcdha1 A G 18: 37,065,415 (GRCm39) D693G probably benign Het
Pik3r5 G A 11: 68,368,294 (GRCm39) D100N possibly damaging Het
Pld3 T C 7: 27,231,796 (GRCm39) D465G probably damaging Het
Prkdc T C 16: 15,496,172 (GRCm39) Y788H probably damaging Het
Rasgrp3 T A 17: 75,823,354 (GRCm39) M475K probably benign Het
Rbak A G 5: 143,159,064 (GRCm39) L663P probably damaging Het
Rnf17 A G 14: 56,719,590 (GRCm39) N947D probably damaging Het
Ryr2 T C 13: 11,702,795 (GRCm39) S2898G probably benign Het
Serpina1e A C 12: 103,917,087 (GRCm39) L194R probably damaging Het
Smg6 T C 11: 74,944,724 (GRCm39) S158P probably damaging Het
Smtnl2 A T 11: 72,292,342 (GRCm39) V269E possibly damaging Het
Snx14 G T 9: 88,265,855 (GRCm39) P760Q probably damaging Het
Sorl1 T C 9: 41,948,508 (GRCm39) E759G possibly damaging Het
Sspo C T 6: 48,473,588 (GRCm39) T4906M possibly damaging Het
Syne2 T A 12: 75,991,944 (GRCm39) F1970I possibly damaging Het
Tekt3 C A 11: 62,974,768 (GRCm39) H362Q probably benign Het
Tmem121 T C 12: 113,152,547 (GRCm39) V255A possibly damaging Het
Tmem201 T C 4: 149,802,534 (GRCm39) T614A probably benign Het
Tnc T C 4: 63,935,916 (GRCm39) D340G probably damaging Het
Ttc28 A T 5: 111,373,794 (GRCm39) T1046S probably benign Het
Ubxn2a T C 12: 4,952,238 (GRCm39) D8G probably benign Het
Vwde T C 6: 13,186,937 (GRCm39) N850S probably benign Het
Zfp280d A G 9: 72,231,417 (GRCm39) H451R probably damaging Het
Zfp462 T C 4: 55,009,818 (GRCm39) C595R probably damaging Het
Zfp768 A G 7: 126,943,583 (GRCm39) S182P probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATACCTGATAGAAATGAGGCC -3'
(R):5'- TGGCTTCTTCAGAGTCAACCTG -3'

Sequencing Primer
(F):5'- CCAGAAGGTGCTGATGGC -3'
(R):5'- ATCCCTTCTTGGTACCATGTATAGG -3'
Posted On 2016-10-05