Incidental Mutation 'R5518:G3bp2'
ID 431391
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene Name GTPase activating protein (SH3 domain) binding protein 2
Synonyms G3BP, E430034L04Rik, G3BP2
MMRRC Submission 043077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5518 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92052146-92083719 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92068488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 63 (H63L)
Ref Sequence ENSEMBL: ENSMUSP00000144456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000201820] [ENSMUST00000202123] [ENSMUST00000202258]
AlphaFold P97379
Predicted Effect probably benign
Transcript: ENSMUST00000113127
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164378
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167918
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169094
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201820
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144404
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 117 9.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201824
Predicted Effect probably benign
Transcript: ENSMUST00000202123
AA Change: H63L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143804
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202125
Predicted Effect probably benign
Transcript: ENSMUST00000202258
AA Change: H63L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405
AA Change: H63L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202352
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 46,120,449 E881K probably benign Het
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Abl1 T A 2: 31,790,742 C349S probably damaging Het
Acot11 C A 4: 106,750,010 V459L probably benign Het
Ank2 A T 3: 126,959,699 V311D probably damaging Het
Ankrd11 C G 8: 122,890,994 E2040Q possibly damaging Het
Ankrd26 T C 6: 118,548,908 I359V probably benign Het
Armc3 T G 2: 19,297,928 L684V probably benign Het
Asb10 G A 5: 24,539,645 P184S probably damaging Het
Atp10b T C 11: 43,151,636 S8P possibly damaging Het
Blk G T 14: 63,378,507 S324R possibly damaging Het
C4b G C 17: 34,734,442 N1022K probably benign Het
Card6 G T 15: 5,105,214 T169K probably damaging Het
Catsper2 T C 2: 121,406,363 T268A possibly damaging Het
Cbx3 C T 6: 51,481,746 P64S probably benign Het
Chchd6 A G 6: 89,567,585 probably null Het
Cntn1 G A 15: 92,314,653 E899K probably benign Het
Col6a4 A T 9: 106,072,188 S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 N84T probably benign Het
Dcxr A C 11: 120,726,199 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Emsy T C 7: 98,593,611 Q1107R possibly damaging Het
Erbb2 G T 11: 98,422,770 C221F probably damaging Het
Exoc3l T C 8: 105,293,163 N353D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt17 A G 5: 130,900,590 Y460H probably damaging Het
Gm6003 T A 7: 33,165,579 noncoding transcript Het
Gm884 A T 11: 103,615,253 I1963K probably benign Het
Ighv5-12-4 A G 12: 113,762,534 L23P probably damaging Het
Ins1 T C 19: 52,264,739 L39P probably damaging Het
Itpr3 T G 17: 27,087,592 V210G probably damaging Het
Klrb1 T A 6: 128,706,525 T210S probably benign Het
Krtap24-1 A T 16: 88,611,708 F177I probably damaging Het
Mcat A G 15: 83,547,674 probably null Het
Mknk2 A T 10: 80,668,641 C229S possibly damaging Het
Mta2 C A 19: 8,948,092 Q362K probably benign Het
Ndst4 T C 3: 125,438,456 Y225H probably benign Het
Olfr1423 T C 19: 12,036,065 R226G probably damaging Het
Pcdha1 A G 18: 36,932,362 D693G probably benign Het
Pik3r5 G A 11: 68,477,468 D100N possibly damaging Het
Pld3 T C 7: 27,532,371 D465G probably damaging Het
Prkdc T C 16: 15,678,308 Y788H probably damaging Het
Ptprt T A 2: 162,278,223 D108V probably damaging Het
Rasgrp3 T A 17: 75,516,359 M475K probably benign Het
Rbak A G 5: 143,173,309 L663P probably damaging Het
Rnf17 A G 14: 56,482,133 N947D probably damaging Het
Ryr2 T C 13: 11,687,909 S2898G probably benign Het
Serpina1e A C 12: 103,950,828 L194R probably damaging Het
Smg6 T C 11: 75,053,898 S158P probably damaging Het
Smtnl2 A T 11: 72,401,516 V269E possibly damaging Het
Snx14 G T 9: 88,383,802 P760Q probably damaging Het
Sorl1 T C 9: 42,037,212 E759G possibly damaging Het
Sspo C T 6: 48,496,654 T4906M possibly damaging Het
Syne2 T A 12: 75,945,170 F1970I possibly damaging Het
Tekt3 C A 11: 63,083,942 H362Q probably benign Het
Tmem121 T C 12: 113,188,927 V255A possibly damaging Het
Tmem201 T C 4: 149,718,077 T614A probably benign Het
Tnc T C 4: 64,017,679 D340G probably damaging Het
Ttc28 A T 5: 111,225,928 T1046S probably benign Het
Ubxn2a T C 12: 4,902,238 D8G probably benign Het
Vwde T C 6: 13,186,938 N850S probably benign Het
Zfp280d A G 9: 72,324,135 H451R probably damaging Het
Zfp462 T C 4: 55,009,818 C595R probably damaging Het
Zfp768 A G 7: 127,344,411 S182P probably benign Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1067:G3bp2 UTSW 5 92063328 splice site probably benign
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R2294:G3bp2 UTSW 5 92058028 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5680:G3bp2 UTSW 5 92068360 missense probably damaging 1.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
R8769:G3bp2 UTSW 5 92083497 intron probably benign
R8945:G3bp2 UTSW 5 92068422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAAACTTACTTCTGGAGCC -3'
(R):5'- ACACAGTATCAAGACGCATTAGGAC -3'

Sequencing Primer
(F):5'- CTGGAGCCAGAACAAAGGTTTGC -3'
(R):5'- CAAGACGCATTAGGACTTCTTG -3'
Posted On 2016-10-05