Incidental Mutation 'R5518:Exoc3l'
ID431407
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Nameexocyst complex component 3-like
SynonymsC730015A04Rik
MMRRC Submission 043077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5518 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105289924-105296101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105293163 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 353 (N353D)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057855
AA Change: N353D

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: N353D

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212529
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 46,120,449 E881K probably benign Het
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Abl1 T A 2: 31,790,742 C349S probably damaging Het
Acot11 C A 4: 106,750,010 V459L probably benign Het
Ank2 A T 3: 126,959,699 V311D probably damaging Het
Ankrd11 C G 8: 122,890,994 E2040Q possibly damaging Het
Ankrd26 T C 6: 118,548,908 I359V probably benign Het
Armc3 T G 2: 19,297,928 L684V probably benign Het
Asb10 G A 5: 24,539,645 P184S probably damaging Het
Atp10b T C 11: 43,151,636 S8P possibly damaging Het
Blk G T 14: 63,378,507 S324R possibly damaging Het
C4b G C 17: 34,734,442 N1022K probably benign Het
Card6 G T 15: 5,105,214 T169K probably damaging Het
Catsper2 T C 2: 121,406,363 T268A possibly damaging Het
Cbx3 C T 6: 51,481,746 P64S probably benign Het
Chchd6 A G 6: 89,567,585 probably null Het
Cntn1 G A 15: 92,314,653 E899K probably benign Het
Col6a4 A T 9: 106,072,188 S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 N84T probably benign Het
Dcxr A C 11: 120,726,199 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Emsy T C 7: 98,593,611 Q1107R possibly damaging Het
Erbb2 G T 11: 98,422,770 C221F probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
G3bp2 T A 5: 92,068,488 H63L probably benign Het
Galnt17 A G 5: 130,900,590 Y460H probably damaging Het
Gm6003 T A 7: 33,165,579 noncoding transcript Het
Gm884 A T 11: 103,615,253 I1963K probably benign Het
Ighv5-12-4 A G 12: 113,762,534 L23P probably damaging Het
Ins1 T C 19: 52,264,739 L39P probably damaging Het
Itpr3 T G 17: 27,087,592 V210G probably damaging Het
Klrb1 T A 6: 128,706,525 T210S probably benign Het
Krtap24-1 A T 16: 88,611,708 F177I probably damaging Het
Mcat A G 15: 83,547,674 probably null Het
Mknk2 A T 10: 80,668,641 C229S possibly damaging Het
Mta2 C A 19: 8,948,092 Q362K probably benign Het
Ndst4 T C 3: 125,438,456 Y225H probably benign Het
Olfr1423 T C 19: 12,036,065 R226G probably damaging Het
Pcdha1 A G 18: 36,932,362 D693G probably benign Het
Pik3r5 G A 11: 68,477,468 D100N possibly damaging Het
Pld3 T C 7: 27,532,371 D465G probably damaging Het
Prkdc T C 16: 15,678,308 Y788H probably damaging Het
Ptprt T A 2: 162,278,223 D108V probably damaging Het
Rasgrp3 T A 17: 75,516,359 M475K probably benign Het
Rbak A G 5: 143,173,309 L663P probably damaging Het
Rnf17 A G 14: 56,482,133 N947D probably damaging Het
Ryr2 T C 13: 11,687,909 S2898G probably benign Het
Serpina1e A C 12: 103,950,828 L194R probably damaging Het
Smg6 T C 11: 75,053,898 S158P probably damaging Het
Smtnl2 A T 11: 72,401,516 V269E possibly damaging Het
Snx14 G T 9: 88,383,802 P760Q probably damaging Het
Sorl1 T C 9: 42,037,212 E759G possibly damaging Het
Sspo C T 6: 48,496,654 T4906M possibly damaging Het
Syne2 T A 12: 75,945,170 F1970I possibly damaging Het
Tekt3 C A 11: 63,083,942 H362Q probably benign Het
Tmem121 T C 12: 113,188,927 V255A possibly damaging Het
Tmem201 T C 4: 149,718,077 T614A probably benign Het
Tnc T C 4: 64,017,679 D340G probably damaging Het
Ttc28 A T 5: 111,225,928 T1046S probably benign Het
Ubxn2a T C 12: 4,902,238 D8G probably benign Het
Vwde T C 6: 13,186,938 N850S probably benign Het
Zfp280d A G 9: 72,324,135 H451R probably damaging Het
Zfp462 T C 4: 55,009,818 C595R probably damaging Het
Zfp768 A G 7: 127,344,411 S182P probably benign Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 105290498 missense probably benign 0.25
IGL01731:Exoc3l APN 8 105292955 missense probably benign 0.16
IGL02364:Exoc3l APN 8 105290577 missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 105292438 missense probably damaging 1.00
IGL02512:Exoc3l APN 8 105290483 missense probably damaging 1.00
IGL02810:Exoc3l APN 8 105295348 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0183:Exoc3l UTSW 8 105295300 missense probably damaging 1.00
R0302:Exoc3l UTSW 8 105293543 missense probably benign 0.01
R1660:Exoc3l UTSW 8 105293060 critical splice donor site probably null
R1699:Exoc3l UTSW 8 105295013 missense probably benign 0.34
R1826:Exoc3l UTSW 8 105293618 missense probably damaging 0.97
R2275:Exoc3l UTSW 8 105290447 critical splice donor site probably null
R3928:Exoc3l UTSW 8 105290917 unclassified probably benign
R3938:Exoc3l UTSW 8 105293405 missense probably damaging 1.00
R4261:Exoc3l UTSW 8 105290967 missense probably damaging 0.98
R4273:Exoc3l UTSW 8 105289961 makesense probably null
R6471:Exoc3l UTSW 8 105290534 missense probably damaging 1.00
R6511:Exoc3l UTSW 8 105293255 missense probably benign 0.00
R6631:Exoc3l UTSW 8 105295361 missense probably damaging 1.00
R6694:Exoc3l UTSW 8 105290490 missense probably benign 0.15
R6843:Exoc3l UTSW 8 105290097 missense probably benign 0.00
R7310:Exoc3l UTSW 8 105293708 missense probably damaging 1.00
R7387:Exoc3l UTSW 8 105294973 missense probably damaging 1.00
R7442:Exoc3l UTSW 8 105292926 missense probably damaging 1.00
R7764:Exoc3l UTSW 8 105290701 missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 105290150 missense probably damaging 1.00
Z1176:Exoc3l UTSW 8 105290794 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACTGAGCCACACTTACCTGG -3'
(R):5'- AGACTGAGCGCACAATCCTG -3'

Sequencing Primer
(F):5'- ACACTTACCTGGCAAGAAAGAG -3'
(R):5'- ATGTCTTCGGGCGCTACAG -3'
Posted On2016-10-05