Incidental Mutation 'R5518:Card6'
ID431429
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
MMRRC Submission 043077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5518 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5105214 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 169 (T169K)
Ref Sequence ENSEMBL: ENSMUSP00000118817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365] [ENSMUST00000141020]
Predicted Effect probably damaging
Transcript: ENSMUST00000118365
AA Change: T169K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: T169K

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141020
AA Change: T169K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118817
Gene: ENSMUSG00000041849
AA Change: T169K

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
Meta Mutation Damage Score 0.2459 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 94.2%
  • 20x: 86.3%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C T 7: 46,120,449 E881K probably benign Het
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Abl1 T A 2: 31,790,742 C349S probably damaging Het
Acot11 C A 4: 106,750,010 V459L probably benign Het
Ank2 A T 3: 126,959,699 V311D probably damaging Het
Ankrd11 C G 8: 122,890,994 E2040Q possibly damaging Het
Ankrd26 T C 6: 118,548,908 I359V probably benign Het
Armc3 T G 2: 19,297,928 L684V probably benign Het
Asb10 G A 5: 24,539,645 P184S probably damaging Het
Atp10b T C 11: 43,151,636 S8P possibly damaging Het
Blk G T 14: 63,378,507 S324R possibly damaging Het
C4b G C 17: 34,734,442 N1022K probably benign Het
Catsper2 T C 2: 121,406,363 T268A possibly damaging Het
Cbx3 C T 6: 51,481,746 P64S probably benign Het
Chchd6 A G 6: 89,567,585 probably null Het
Cntn1 G A 15: 92,314,653 E899K probably benign Het
Col6a4 A T 9: 106,072,188 S749R possibly damaging Het
Cpne3 T G 4: 19,553,779 N84T probably benign Het
Dcxr A C 11: 120,726,199 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Emsy T C 7: 98,593,611 Q1107R possibly damaging Het
Erbb2 G T 11: 98,422,770 C221F probably damaging Het
Exoc3l T C 8: 105,293,163 N353D probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
G3bp2 T A 5: 92,068,488 H63L probably benign Het
Galnt17 A G 5: 130,900,590 Y460H probably damaging Het
Gm6003 T A 7: 33,165,579 noncoding transcript Het
Gm884 A T 11: 103,615,253 I1963K probably benign Het
Ighv5-12-4 A G 12: 113,762,534 L23P probably damaging Het
Ins1 T C 19: 52,264,739 L39P probably damaging Het
Itpr3 T G 17: 27,087,592 V210G probably damaging Het
Klrb1 T A 6: 128,706,525 T210S probably benign Het
Krtap24-1 A T 16: 88,611,708 F177I probably damaging Het
Mcat A G 15: 83,547,674 probably null Het
Mknk2 A T 10: 80,668,641 C229S possibly damaging Het
Mta2 C A 19: 8,948,092 Q362K probably benign Het
Ndst4 T C 3: 125,438,456 Y225H probably benign Het
Olfr1423 T C 19: 12,036,065 R226G probably damaging Het
Pcdha1 A G 18: 36,932,362 D693G probably benign Het
Pik3r5 G A 11: 68,477,468 D100N possibly damaging Het
Pld3 T C 7: 27,532,371 D465G probably damaging Het
Prkdc T C 16: 15,678,308 Y788H probably damaging Het
Ptprt T A 2: 162,278,223 D108V probably damaging Het
Rasgrp3 T A 17: 75,516,359 M475K probably benign Het
Rbak A G 5: 143,173,309 L663P probably damaging Het
Rnf17 A G 14: 56,482,133 N947D probably damaging Het
Ryr2 T C 13: 11,687,909 S2898G probably benign Het
Serpina1e A C 12: 103,950,828 L194R probably damaging Het
Smg6 T C 11: 75,053,898 S158P probably damaging Het
Smtnl2 A T 11: 72,401,516 V269E possibly damaging Het
Snx14 G T 9: 88,383,802 P760Q probably damaging Het
Sorl1 T C 9: 42,037,212 E759G possibly damaging Het
Sspo C T 6: 48,496,654 T4906M possibly damaging Het
Syne2 T A 12: 75,945,170 F1970I possibly damaging Het
Tekt3 C A 11: 63,083,942 H362Q probably benign Het
Tmem121 T C 12: 113,188,927 V255A possibly damaging Het
Tmem201 T C 4: 149,718,077 T614A probably benign Het
Tnc T C 4: 64,017,679 D340G probably damaging Het
Ttc28 A T 5: 111,225,928 T1046S probably benign Het
Ubxn2a T C 12: 4,902,238 D8G probably benign Het
Vwde T C 6: 13,186,938 N850S probably benign Het
Zfp280d A G 9: 72,324,135 H451R probably damaging Het
Zfp462 T C 4: 55,009,818 C595R probably damaging Het
Zfp768 A G 7: 127,344,411 S182P probably benign Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8295:Card6 UTSW 15 5098691 small deletion probably benign
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8431:Card6 UTSW 15 5100276 missense probably damaging 0.98
R8691:Card6 UTSW 15 5099596 missense possibly damaging 0.76
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAAGCACTGTGGGTCCTTG -3'
(R):5'- TTCAGAAGTTCCACGGCAGG -3'

Sequencing Primer
(F):5'- GCCGGCCTCTTCCTCCAAG -3'
(R):5'- ACAGGAATTCTGAAGATCCCCTTTC -3'
Posted On2016-10-05