Incidental Mutation 'R5519:Col9a1'
ID431442
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Namecollagen, type IX, alpha 1
SynonymsCol9a-1
MMRRC Submission 043078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5519 (G1)
Quality Score194
Status Not validated
Chromosome1
Chromosomal Location24177610-24252684 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 24230254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588] [ENSMUST00000088349]
Predicted Effect probably null
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088349
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147902
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,002,992 V99A possibly damaging Het
2510009E07Rik A G 16: 21,653,468 S91P probably benign Het
2810021J22Rik G A 11: 58,880,097 S135N probably benign Het
A530084C06Rik T C 13: 31,558,719 probably benign Het
Acadsb T C 7: 131,429,965 S177P probably damaging Het
Acpp C A 9: 104,291,488 G393W probably damaging Het
Axl G A 7: 25,778,662 A204V possibly damaging Het
Birc6 A T 17: 74,580,178 M806L probably benign Het
Cacna1i T C 15: 80,371,499 L861P probably damaging Het
Cfap44 A T 16: 44,404,088 D53V probably damaging Het
Ctf2 T A 7: 127,719,291 I179L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Emilin2 G A 17: 71,252,935 P1016S probably benign Het
Gm12790 G A 4: 101,967,691 P127S probably benign Het
Gsap T A 5: 21,289,859 V24E probably damaging Het
Ipp T C 4: 116,510,767 F66L possibly damaging Het
Jakmip3 T C 7: 139,007,791 I208T probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mosmo C T 7: 120,730,510 P118L probably benign Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr643 G A 7: 104,059,297 Q102* probably null Het
Padi2 A G 4: 140,949,222 D557G probably damaging Het
Pde11a T A 2: 76,075,955 K639N probably damaging Het
Pspc1 T C 14: 56,771,956 I140M probably benign Het
Rundc3a A T 11: 102,402,031 I417F probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Serpinb3b A G 1: 107,159,776 M1T probably null Het
Sin3a T C 9: 57,118,173 probably null Het
St8sia1 T C 6: 142,963,561 N70D probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tpm2 T G 4: 43,522,751 D55A possibly damaging Het
Trdv1 T A 14: 53,881,948 M22K probably benign Het
Zc3h4 A T 7: 16,435,232 T1089S unknown Het
Zfp518b G A 5: 38,674,098 T188M probably damaging Het
Zfp74 G T 7: 29,935,134 A383D probably damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24179501 missense unknown
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7177:Col9a1 UTSW 1 24195417 missense unknown
R7259:Col9a1 UTSW 1 24185343 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24179403 intron probably null
R7644:Col9a1 UTSW 1 24185162 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGATGGGAGATTTTGGCAAC -3'
(R):5'- TGCATTCTACAAGCCACGCTG -3'

Sequencing Primer
(F):5'- CACCTATATTTTACCAAAAGCCTGG -3'
(R):5'- GCCACGCTGATTAAAATACTCATG -3'
Posted On2016-10-05