Incidental Mutation 'R5519:Tdpoz4'
ID431447
Institutional Source Beutler Lab
Gene Symbol Tdpoz4
Ensembl Gene ENSMUSG00000060256
Gene NameTD and POZ domain containing 4
Synonyms
MMRRC Submission 043078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R5519 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93796398-93797510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93797499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 368 (T368S)
Ref Sequence ENSEMBL: ENSMUSP00000075338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075953]
Predicted Effect probably benign
Transcript: ENSMUST00000075953
AA Change: T368S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075338
Gene: ENSMUSG00000060256
AA Change: T368S

DomainStartEndE-ValueType
MATH 24 130 4.81e-2 SMART
BTB 188 287 2.9e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,002,992 V99A possibly damaging Het
2510009E07Rik A G 16: 21,653,468 S91P probably benign Het
2810021J22Rik G A 11: 58,880,097 S135N probably benign Het
A530084C06Rik T C 13: 31,558,719 probably benign Het
Acadsb T C 7: 131,429,965 S177P probably damaging Het
Acpp C A 9: 104,291,488 G393W probably damaging Het
Axl G A 7: 25,778,662 A204V possibly damaging Het
Birc6 A T 17: 74,580,178 M806L probably benign Het
Cacna1i T C 15: 80,371,499 L861P probably damaging Het
Cfap44 A T 16: 44,404,088 D53V probably damaging Het
Col9a1 G A 1: 24,230,254 probably null Het
Ctf2 T A 7: 127,719,291 I179L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Emilin2 G A 17: 71,252,935 P1016S probably benign Het
Gm12790 G A 4: 101,967,691 P127S probably benign Het
Gsap T A 5: 21,289,859 V24E probably damaging Het
Ipp T C 4: 116,510,767 F66L possibly damaging Het
Jakmip3 T C 7: 139,007,791 I208T probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mosmo C T 7: 120,730,510 P118L probably benign Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr643 G A 7: 104,059,297 Q102* probably null Het
Padi2 A G 4: 140,949,222 D557G probably damaging Het
Pde11a T A 2: 76,075,955 K639N probably damaging Het
Pspc1 T C 14: 56,771,956 I140M probably benign Het
Rundc3a A T 11: 102,402,031 I417F probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Serpinb3b A G 1: 107,159,776 M1T probably null Het
Sin3a T C 9: 57,118,173 probably null Het
St8sia1 T C 6: 142,963,561 N70D probably damaging Het
Tpm2 T G 4: 43,522,751 D55A possibly damaging Het
Trdv1 T A 14: 53,881,948 M22K probably benign Het
Zc3h4 A T 7: 16,435,232 T1089S unknown Het
Zfp518b G A 5: 38,674,098 T188M probably damaging Het
Zfp74 G T 7: 29,935,134 A383D probably damaging Het
Other mutations in Tdpoz4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tdpoz4 APN 3 93797073 missense probably benign 0.22
IGL01731:Tdpoz4 APN 3 93796882 missense possibly damaging 0.62
IGL01934:Tdpoz4 APN 3 93797472 missense probably damaging 1.00
IGL03269:Tdpoz4 APN 3 93796837 missense probably damaging 1.00
FR4340:Tdpoz4 UTSW 3 93796880 frame shift probably null
FR4342:Tdpoz4 UTSW 3 93796880 frame shift probably null
R0387:Tdpoz4 UTSW 3 93796700 missense probably benign 0.26
R1134:Tdpoz4 UTSW 3 93797218 missense probably benign 0.42
R1299:Tdpoz4 UTSW 3 93796462 missense probably benign 0.26
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R2113:Tdpoz4 UTSW 3 93797044 missense probably damaging 1.00
R4601:Tdpoz4 UTSW 3 93797032 missense probably damaging 1.00
R4738:Tdpoz4 UTSW 3 93797089 missense probably damaging 1.00
R4948:Tdpoz4 UTSW 3 93797011 missense probably damaging 1.00
R5495:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5550:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5595:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5596:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5615:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R7198:Tdpoz4 UTSW 3 93797355 missense probably benign 0.16
R7290:Tdpoz4 UTSW 3 93796848 missense not run
R7677:Tdpoz4 UTSW 3 93797508 makesense probably null
X0066:Tdpoz4 UTSW 3 93796968 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTCTCTGTGGAGAATGCTG -3'
(R):5'- GTTCCAGATTCCAATGCTGTCC -3'

Sequencing Primer
(F):5'- TGAAGACTCAGGCCCTGGATTTC -3'
(R):5'- AGATTCCAATGCTGTCCATTTTC -3'
Posted On2016-10-05