Incidental Mutation 'R5519:Ctf2'
ID431462
Institutional Source Beutler Lab
Gene Symbol Ctf2
Ensembl Gene ENSMUSG00000060034
Gene Namecardiotrophin 2
SynonymsLOC244218, neuropoietin, NP
MMRRC Submission 043078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5519 (G1)
Quality Score208
Status Not validated
Chromosome7
Chromosomal Location127718106-127732166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127719291 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 179 (I179L)
Ref Sequence ENSEMBL: ENSMUSP00000075459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047393] [ENSMUST00000076091] [ENSMUST00000206038] [ENSMUST00000206506] [ENSMUST00000206997]
Predicted Effect probably benign
Transcript: ENSMUST00000047393
SMART Domains Protein: ENSMUSP00000049161
Gene: ENSMUSG00000042340

DomainStartEndE-ValueType
SCOP:d1cnt1_ 21 197 1e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076091
AA Change: I179L

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075459
Gene: ENSMUSG00000060034
AA Change: I179L

DomainStartEndE-ValueType
Pfam:CNTF 22 204 1.6e-15 PFAM
Pfam:PRF 31 204 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205655
Predicted Effect probably benign
Transcript: ENSMUST00000206038
AA Change: I139L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206073
Predicted Effect probably benign
Transcript: ENSMUST00000206506
Predicted Effect probably benign
Transcript: ENSMUST00000206997
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,002,992 V99A possibly damaging Het
2510009E07Rik A G 16: 21,653,468 S91P probably benign Het
2810021J22Rik G A 11: 58,880,097 S135N probably benign Het
A530084C06Rik T C 13: 31,558,719 probably benign Het
Acadsb T C 7: 131,429,965 S177P probably damaging Het
Acpp C A 9: 104,291,488 G393W probably damaging Het
Axl G A 7: 25,778,662 A204V possibly damaging Het
Birc6 A T 17: 74,580,178 M806L probably benign Het
Cacna1i T C 15: 80,371,499 L861P probably damaging Het
Cfap44 A T 16: 44,404,088 D53V probably damaging Het
Col9a1 G A 1: 24,230,254 probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Emilin2 G A 17: 71,252,935 P1016S probably benign Het
Gm12790 G A 4: 101,967,691 P127S probably benign Het
Gsap T A 5: 21,289,859 V24E probably damaging Het
Ipp T C 4: 116,510,767 F66L possibly damaging Het
Jakmip3 T C 7: 139,007,791 I208T probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mosmo C T 7: 120,730,510 P118L probably benign Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr643 G A 7: 104,059,297 Q102* probably null Het
Padi2 A G 4: 140,949,222 D557G probably damaging Het
Pde11a T A 2: 76,075,955 K639N probably damaging Het
Pspc1 T C 14: 56,771,956 I140M probably benign Het
Rundc3a A T 11: 102,402,031 I417F probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Serpinb3b A G 1: 107,159,776 M1T probably null Het
Sin3a T C 9: 57,118,173 probably null Het
St8sia1 T C 6: 142,963,561 N70D probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tpm2 T G 4: 43,522,751 D55A possibly damaging Het
Trdv1 T A 14: 53,881,948 M22K probably benign Het
Zc3h4 A T 7: 16,435,232 T1089S unknown Het
Zfp518b G A 5: 38,674,098 T188M probably damaging Het
Zfp74 G T 7: 29,935,134 A383D probably damaging Het
Other mutations in Ctf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1166:Ctf2 UTSW 7 127719513 missense probably benign 0.01
R2417:Ctf2 UTSW 7 127719587 missense probably benign 0.01
R4574:Ctf2 UTSW 7 127719384 missense possibly damaging 0.83
R4652:Ctf2 UTSW 7 127719384 missense probably benign 0.00
R6436:Ctf2 UTSW 7 127719431 missense probably damaging 1.00
R7161:Ctf2 UTSW 7 127719304 missense probably damaging 1.00
Z1176:Ctf2 UTSW 7 127719456 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGGACCTGGCAGGAAGATC -3'
(R):5'- TTATCTGAATCCTGGCAGTCC -3'

Sequencing Primer
(F):5'- CAATAAGGAGTAGAGGTTTGGCTTCC -3'
(R):5'- GAATCCTGGCAGTCCTATCCTG -3'
Posted On2016-10-05