Incidental Mutation 'R5519:Trdv1'
ID431473
Institutional Source Beutler Lab
Gene Symbol Trdv1
Ensembl Gene ENSMUSG00000076864
Gene NameT cell receptor delta variable 1
Synonyms
MMRRC Submission 043078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R5519 (G1)
Quality Score224
Status Not validated
Chromosome14
Chromosomal Location53881532-53882216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53881948 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 22 (M22K)
Ref Sequence ENSEMBL: ENSMUSP00000139783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103676] [ENSMUST00000187163]
Predicted Effect probably benign
Transcript: ENSMUST00000103676
AA Change: M23K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100453
Gene: ENSMUSG00000076864
AA Change: M23K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ig 26 112 6.7e-7 PFAM
Pfam:V-set 26 112 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187163
AA Change: M22K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139783
Gene: ENSMUSG00000076864
AA Change: M22K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG_like 37 110 6.4e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.7%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,002,992 V99A possibly damaging Het
2510009E07Rik A G 16: 21,653,468 S91P probably benign Het
2810021J22Rik G A 11: 58,880,097 S135N probably benign Het
A530084C06Rik T C 13: 31,558,719 probably benign Het
Acadsb T C 7: 131,429,965 S177P probably damaging Het
Acpp C A 9: 104,291,488 G393W probably damaging Het
Axl G A 7: 25,778,662 A204V possibly damaging Het
Birc6 A T 17: 74,580,178 M806L probably benign Het
Cacna1i T C 15: 80,371,499 L861P probably damaging Het
Cfap44 A T 16: 44,404,088 D53V probably damaging Het
Col9a1 G A 1: 24,230,254 probably null Het
Ctf2 T A 7: 127,719,291 I179L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Emilin2 G A 17: 71,252,935 P1016S probably benign Het
Gm12790 G A 4: 101,967,691 P127S probably benign Het
Gsap T A 5: 21,289,859 V24E probably damaging Het
Ipp T C 4: 116,510,767 F66L possibly damaging Het
Jakmip3 T C 7: 139,007,791 I208T probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mosmo C T 7: 120,730,510 P118L probably benign Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr643 G A 7: 104,059,297 Q102* probably null Het
Padi2 A G 4: 140,949,222 D557G probably damaging Het
Pde11a T A 2: 76,075,955 K639N probably damaging Het
Pspc1 T C 14: 56,771,956 I140M probably benign Het
Rundc3a A T 11: 102,402,031 I417F probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Serpinb3b A G 1: 107,159,776 M1T probably null Het
Sin3a T C 9: 57,118,173 probably null Het
St8sia1 T C 6: 142,963,561 N70D probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tpm2 T G 4: 43,522,751 D55A possibly damaging Het
Zc3h4 A T 7: 16,435,232 T1089S unknown Het
Zfp518b G A 5: 38,674,098 T188M probably damaging Het
Zfp74 G T 7: 29,935,134 A383D probably damaging Het
Other mutations in Trdv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1354:Trdv1 UTSW 14 53881918 intron probably benign
R2091:Trdv1 UTSW 14 53882169 missense probably benign 0.11
R4903:Trdv1 UTSW 14 53881918 intron probably benign
R6077:Trdv1 UTSW 14 53882056 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGCTTGCTTGGCTATTGAC -3'
(R):5'- CCAGATTAGCGGTTATTTTGTCC -3'

Sequencing Primer
(F):5'- CAGGCTGCCTGTGAGTACATATTTC -3'
(R):5'- AGCGGTTATTTTGTCCTTACTTTTC -3'
Posted On2016-10-05