Incidental Mutation 'R5520:Gm438'
ID431496
Institutional Source Beutler Lab
Gene Symbol Gm438
Ensembl Gene ENSMUSG00000078504
Gene Namepredicted gene 438
SynonymsLOC329993
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144777204-144786583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144778024 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 186 (T186S)
Ref Sequence ENSEMBL: ENSMUSP00000101372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105746]
Predicted Effect probably benign
Transcript: ENSMUST00000105746
AA Change: T186S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101372
Gene: ENSMUSG00000078504
AA Change: T186S

DomainStartEndE-ValueType
transmembrane domain 3 25 N/A INTRINSIC
Pfam:Abhydrolase_3 111 270 4.9e-22 PFAM
Pfam:Abhydrolase_3 284 366 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Gm438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm438 APN 4 144777689 nonsense probably null
IGL01293:Gm438 APN 4 144777589 missense probably benign 0.00
IGL01678:Gm438 APN 4 144777873 missense probably benign 0.20
IGL02609:Gm438 APN 4 144779737 missense probably damaging 1.00
IGL02684:Gm438 APN 4 144778185 splice site probably benign
IGL02734:Gm438 APN 4 144779779 missense probably damaging 1.00
IGL02869:Gm438 APN 4 144786368 missense probably benign 0.01
IGL02988:Gm438 APN 4 144786530 utr 5 prime probably benign
R0553:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R1514:Gm438 UTSW 4 144777759 missense probably damaging 1.00
R1856:Gm438 UTSW 4 144777883 missense probably benign
R1957:Gm438 UTSW 4 144777819 missense possibly damaging 0.94
R2014:Gm438 UTSW 4 144779725 missense probably damaging 1.00
R2243:Gm438 UTSW 4 144777421 missense probably benign
R4943:Gm438 UTSW 4 144777720 missense probably benign 0.07
R5439:Gm438 UTSW 4 144778113 missense probably damaging 1.00
R6414:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R6664:Gm438 UTSW 4 144777399 makesense probably null
R6869:Gm438 UTSW 4 144780472 critical splice donor site probably null
R7384:Gm438 UTSW 4 144780621 missense possibly damaging 0.89
R7439:Gm438 UTSW 4 144777762 missense probably damaging 1.00
R7484:Gm438 UTSW 4 144777951 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAAGAGAGATCAATGGCCAG -3'
(R):5'- AATCGCCTCCTGTGATCCAG -3'

Sequencing Primer
(F):5'- GAGATCAATGGCCAGGTATTTAC -3'
(R):5'- CCTCCTGTGATCCAGTTGTAAAGAG -3'
Posted On2016-10-05