Mutagenetix > Incidental Mutations

Incidental Mutation 'R0469:Bicc1'

43150

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

038669-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0469 (G1)

Quality Score

170

Status

Not validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71079215 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 73 (R73L)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

Predicted Effect

probably benign
Transcript: ENSMUST00000014473
AA Change: R73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: R73L

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131445

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143791
AA Change: R73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: R73L

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160178

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Arih2	T	A	9: 108,605,092	H490L	possibly damaging	Het
Arpc1b	T	A	5: 145,127,715	W361R	probably damaging	Het
B3gntl1	A	T	11: 121,673,025	V3D	probably benign	Het
Baiap2l1	T	C	5: 144,275,891	Y438C	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cep76	A	T	18: 67,634,780	N227K	probably benign	Het
Col6a4	A	T	9: 106,080,547	V26D	probably damaging	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dnah12	A	G	14: 26,798,899	R1892G	probably damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Ggn	C	T	7: 29,171,296	P47S	probably damaging	Het
Gli3	T	G	13: 15,724,785	L919R	probably damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Golgb1	A	G	16: 36,931,635	I3144V	probably benign	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gpr39	C	T	1: 125,677,500	T55M	probably damaging	Het
Grk4	A	G	5: 34,716,213	T208A	probably damaging	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Hnrnph3	T	A	10: 63,018,215	R41S	probably benign	Het
Hnrnph3	T	A	10: 63,019,500	D2V	probably damaging	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Naca	C	T	10: 128,044,790	A1897V	probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr338	A	T	2: 36,377,462	I229F	probably benign	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pkn1	C	A	8: 83,672,324	C678F	probably damaging	Het
Pla2g4a	T	A	1: 149,840,647	M688L	possibly damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Psen2	T	C	1: 180,238,914	T153A	probably damaging	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rbp3	A	G	14: 33,962,419	K1135R	possibly damaging	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Sncaip	A	G	18: 52,868,709	T101A	probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Stk11	T	C	10: 80,126,086	V47A	probably damaging	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Tas2r123	T	C	6: 132,847,332	V64A	probably benign	Het
Tm9sf1	A	T	14: 55,641,429	F169I	possibly damaging	Het
Tmpo	A	C	10: 91,163,096	I276M	probably benign	Het
Tnnc1	A	G	14: 31,211,408	D149G	probably damaging	Het
Tpr	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	1: 150,423,667		probably null	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trim55	G	T	3: 19,671,092	V258L	possibly damaging	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ube2u	A	G	4: 100,486,673	I90V	probably benign	Het
Upb1	T	C	10: 75,415,083		probably null	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0184:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4765:Bicc1	UTSW	10	70940593	missense	probably damaging	1.00
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R5749:Bicc1	UTSW	10	70946969	missense	probably benign	0.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7351:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R7747:Bicc1	UTSW	10	70946993	missense	probably benign
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACTTGTTACAAAACCCAGCCC -3'
(R):5'- GCAGCTTCCATCTAGCATGGAGAC -3'

Sequencing Primer
(F):5'- CAGACACGGTTTGAGCATC -3'
(R):5'- GGGTCTTCCACTTAATCAAGAATGG -3'

Posted On

2013-05-23