Incidental Mutation 'R5520:Doxl2'
ID431500
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5520 (G1)
Quality Score216
Status Not validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48975794 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 218 (Q218K)
Ref Sequence ENSEMBL: ENSMUSP00000087517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090063
AA Change: Q218K

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: Q218K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184917
AA Change: Q218K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: Q218K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1443:Doxl2 UTSW 6 48975915 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2031:Doxl2 UTSW 6 48975855 missense probably damaging 0.99
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R4823:Doxl2 UTSW 6 48975261 missense probably damaging 1.00
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6024:Doxl2 UTSW 6 48976096 missense possibly damaging 0.71
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6268:Doxl2 UTSW 6 48977682 missense probably benign 0.01
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
R7131:Doxl2 UTSW 6 48976372 nonsense probably null
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGCAGAGCAAAGCCTTCTC -3'
(R):5'- TTAAAGACTTGTGGCAGCTCTG -3'

Sequencing Primer
(F):5'- TTCTCTACCACAAAATCAAGGAGG -3'
(R):5'- CAGCTCTGTGTTCTTGGGAC -3'
Posted On2016-10-05