Incidental Mutation 'R5520:Fbxw18'
ID431510
Institutional Source Beutler Lab
Gene Symbol Fbxw18
Ensembl Gene ENSMUSG00000074059
Gene NameF-box and WD-40 domain protein 18
Synonyms
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109676734-109702700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109691521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 257 (H257N)
Ref Sequence ENSEMBL: ENSMUSP00000095962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098359]
Predicted Effect probably benign
Transcript: ENSMUST00000098359
AA Change: H257N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095962
Gene: ENSMUSG00000074059
AA Change: H257N

DomainStartEndE-ValueType
FBOX 8 48 4.13e-6 SMART
Blast:WD40 140 179 2e-7 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Fbxw18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fbxw18 APN 9 109693343 missense probably benign 0.00
IGL00820:Fbxw18 APN 9 109693369 missense probably damaging 1.00
IGL01447:Fbxw18 APN 9 109701607 missense probably damaging 1.00
IGL01511:Fbxw18 APN 9 109688821 missense possibly damaging 0.83
IGL01956:Fbxw18 APN 9 109693357 missense probably damaging 0.98
IGL02089:Fbxw18 APN 9 109701322 missense probably benign 0.00
PIT4810001:Fbxw18 UTSW 9 109676890 nonsense probably null
R0004:Fbxw18 UTSW 9 109701313 missense probably damaging 0.96
R0124:Fbxw18 UTSW 9 109691515 missense probably benign 0.00
R0375:Fbxw18 UTSW 9 109688839 missense possibly damaging 0.63
R1652:Fbxw18 UTSW 9 109690627 missense probably benign 0.35
R2153:Fbxw18 UTSW 9 109693370 missense probably damaging 1.00
R2294:Fbxw18 UTSW 9 109676797 missense probably damaging 1.00
R3738:Fbxw18 UTSW 9 109688913 missense possibly damaging 0.57
R4706:Fbxw18 UTSW 9 109690517 missense probably benign 0.00
R4982:Fbxw18 UTSW 9 109702651 start gained probably benign
R4990:Fbxw18 UTSW 9 109688393 missense probably damaging 0.99
R5314:Fbxw18 UTSW 9 109693178 missense possibly damaging 0.90
R5634:Fbxw18 UTSW 9 109676803 missense possibly damaging 0.49
R5718:Fbxw18 UTSW 9 109691568 missense probably benign 0.01
R5894:Fbxw18 UTSW 9 109700167 missense possibly damaging 0.83
R5928:Fbxw18 UTSW 9 109700081 missense probably damaging 0.99
R6175:Fbxw18 UTSW 9 109676879 missense probably damaging 1.00
R6696:Fbxw18 UTSW 9 109688764 missense probably benign 0.09
R6944:Fbxw18 UTSW 9 109702587 missense probably damaging 1.00
R7396:Fbxw18 UTSW 9 109688886 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTCCATGGCGACTGGTAAGG -3'
(R):5'- GATAACACTGCTTCCTTCATGC -3'

Sequencing Primer
(F):5'- TGGTAAGGTGACTGCTCCCAAG -3'
(R):5'- TTAACCTTTCCCTATTGACCAGGTG -3'
Posted On2016-10-05