Incidental Mutation 'R5520:Ftsj3'
ID431513
Institutional Source Beutler Lab
Gene Symbol Ftsj3
Ensembl Gene ENSMUSG00000020706
Gene NameFtsJ RNA methyltransferase homolog 3 (E. coli)
SynonymsD11Ertd400e, C79843, Epcs3
MMRRC Submission 043079-MU
Accession Numbers

Genbank: NM_025310; MGI: 1860295

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106249142-106256079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106255588 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000021048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021048] [ENSMUST00000021049] [ENSMUST00000133131]
Predicted Effect probably benign
Transcript: ENSMUST00000021048
AA Change: T22A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021048
Gene: ENSMUSG00000020706
AA Change: T22A

DomainStartEndE-ValueType
Pfam:FtsJ 24 200 2.8e-56 PFAM
low complexity region 203 218 N/A INTRINSIC
Pfam:DUF3381 231 398 1.3e-48 PFAM
low complexity region 456 475 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
Pfam:Spb1_C 597 831 1.8e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127803
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154635
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the function of this gene is not known, the existence of this gene is supported by mRNA and EST data. A possible function of the encoded protein can be inferred from amino acid sequence similarity to the E.coli FtsJ protein and to a mouse protein possibly involved in embryogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Ftsj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ftsj3 APN 11 106250179 missense probably damaging 0.99
IGL00964:Ftsj3 APN 11 106253115 missense probably benign 0.00
IGL01025:Ftsj3 APN 11 106250359 missense probably damaging 0.98
IGL01101:Ftsj3 APN 11 106255632 missense probably benign 0.16
IGL01370:Ftsj3 APN 11 106252319 missense possibly damaging 0.79
IGL02000:Ftsj3 APN 11 106250407 missense probably benign 0.03
IGL02139:Ftsj3 APN 11 106254663 missense possibly damaging 0.91
IGL02340:Ftsj3 APN 11 106253146 nonsense probably null
IGL02964:Ftsj3 APN 11 106252337 missense probably damaging 1.00
IGL03136:Ftsj3 APN 11 106253813 missense probably damaging 1.00
D4043:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
LCD18:Ftsj3 UTSW 11 106250059 splice site probably benign
NA:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
P0018:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
P0027:Ftsj3 UTSW 11 106254808 missense possibly damaging 0.91
PIT4581001:Ftsj3 UTSW 11 106249476 missense unknown
R1449:Ftsj3 UTSW 11 106253000 missense probably benign 0.28
R2242:Ftsj3 UTSW 11 106250778 missense probably benign 0.45
R4086:Ftsj3 UTSW 11 106249569 missense probably damaging 1.00
R4356:Ftsj3 UTSW 11 106253676 missense probably benign 0.01
R4358:Ftsj3 UTSW 11 106253676 missense probably benign 0.01
R4943:Ftsj3 UTSW 11 106249518 missense probably damaging 1.00
R5997:Ftsj3 UTSW 11 106252251 missense probably damaging 0.99
R6047:Ftsj3 UTSW 11 106252318 missense probably damaging 0.96
R6180:Ftsj3 UTSW 11 106253340 synonymous probably null
R6771:Ftsj3 UTSW 11 106249540 missense probably damaging 1.00
R7121:Ftsj3 UTSW 11 106252297 missense probably damaging 1.00
R7303:Ftsj3 UTSW 11 106254680 missense probably damaging 1.00
R7349:Ftsj3 UTSW 11 106249746 missense probably damaging 1.00
R7559:Ftsj3 UTSW 11 106252987 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CGATAACCTGGATCGTGGAGAG -3'
(R):5'- ACATGTGCTGCTTCCTAAGAG -3'

Sequencing Primer
(F):5'- GTGGGTGTATAAGGCAATACCGTC -3'
(R):5'- CTTCCTAAGAGTTGAAAACCTGCGG -3'
Posted On2016-10-05