Incidental Mutation 'R5520:R3hcc1'
ID431518
Institutional Source Beutler Lab
Gene Symbol R3hcc1
Ensembl Gene ENSMUSG00000034194
Gene NameR3H domain and coiled-coil containing 1
Synonyms
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location69697307-69707584 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 69698608 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 437 (K437*)
Ref Sequence ENSEMBL: ENSMUSP00000150058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022660] [ENSMUST00000100420] [ENSMUST00000118374] [ENSMUST00000121142] [ENSMUST00000216152]
Predicted Effect probably benign
Transcript: ENSMUST00000022660
SMART Domains Protein: ENSMUSP00000022660
Gene: ENSMUSG00000034205

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 753 1.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100420
SMART Domains Protein: ENSMUSP00000097987
Gene: ENSMUSG00000034205

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 750 1.1e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118374
AA Change: K437*
SMART Domains Protein: ENSMUSP00000113450
Gene: ENSMUSG00000034194
AA Change: K437*

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121142
AA Change: K437*
SMART Domains Protein: ENSMUSP00000113898
Gene: ENSMUSG00000034194
AA Change: K437*

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138326
Predicted Effect probably null
Transcript: ENSMUST00000194548
AA Change: K251*
SMART Domains Protein: ENSMUSP00000141254
Gene: ENSMUSG00000034194
AA Change: K251*

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000216152
AA Change: K437*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in R3hcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:R3hcc1 APN 14 69700028 missense probably damaging 0.99
IGL02089:R3hcc1 APN 14 69700026 missense possibly damaging 0.90
R3737:R3hcc1 UTSW 14 69697593 missense probably benign 0.33
R4041:R3hcc1 UTSW 14 69706662 missense probably damaging 1.00
R4512:R3hcc1 UTSW 14 69698611 missense probably damaging 1.00
R5058:R3hcc1 UTSW 14 69704014 missense probably damaging 1.00
R5159:R3hcc1 UTSW 14 69697604 critical splice acceptor site probably null
R6910:R3hcc1 UTSW 14 69697575 missense probably damaging 1.00
R7019:R3hcc1 UTSW 14 69704125 missense probably damaging 1.00
R7148:R3hcc1 UTSW 14 69705552 missense possibly damaging 0.92
R7392:R3hcc1 UTSW 14 69705880 critical splice acceptor site probably null
R7792:R3hcc1 UTSW 14 69705508 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAAGAAGGTGTGCGCTGG -3'
(R):5'- TTCAGCCTTTACCGAGCTAGGG -3'

Sequencing Primer
(F):5'- GAGCAAACATATATGGTAGCTGAC -3'
(R):5'- CTTTACCGAGCTAGGGCAGAG -3'
Posted On2016-10-05